ID: 1028965198

View in Genome Browser
Species Human (GRCh38)
Location 7:96794372-96794394
Sequence AGTGGGGAATGAAAGTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028965198_1028965203 -5 Left 1028965198 7:96794372-96794394 CCATTAAACTTTCATTCCCCACT No data
Right 1028965203 7:96794390-96794412 CCACTTACTAGGTGTAAACTTGG No data
1028965198_1028965204 -4 Left 1028965198 7:96794372-96794394 CCATTAAACTTTCATTCCCCACT No data
Right 1028965204 7:96794391-96794413 CACTTACTAGGTGTAAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028965198 Original CRISPR AGTGGGGAATGAAAGTTTAA TGG (reversed) Intergenic
No off target data available for this crispr