ID: 1028966064

View in Genome Browser
Species Human (GRCh38)
Location 7:96802600-96802622
Sequence GAAACAGAACTTCAGTCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028966064_1028966066 0 Left 1028966064 7:96802600-96802622 CCTTAAGACTGAAGTTCTGTTTC No data
Right 1028966066 7:96802623-96802645 CTTTATGCGCAAGTTGTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028966064 Original CRISPR GAAACAGAACTTCAGTCTTA AGG (reversed) Intergenic
No off target data available for this crispr