ID: 1028966066

View in Genome Browser
Species Human (GRCh38)
Location 7:96802623-96802645
Sequence CTTTATGCGCAAGTTGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028966064_1028966066 0 Left 1028966064 7:96802600-96802622 CCTTAAGACTGAAGTTCTGTTTC No data
Right 1028966066 7:96802623-96802645 CTTTATGCGCAAGTTGTACCAGG No data
1028966063_1028966066 10 Left 1028966063 7:96802590-96802612 CCAATGTTTACCTTAAGACTGAA No data
Right 1028966066 7:96802623-96802645 CTTTATGCGCAAGTTGTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028966066 Original CRISPR CTTTATGCGCAAGTTGTACC AGG Intergenic
No off target data available for this crispr