ID: 1028977463 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:96930016-96930038 |
| Sequence | TAGAATAAATAGAGGGAGAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1028977463_1028977467 | 7 | Left | 1028977463 | 7:96930016-96930038 | CCTGTCTCCCTCTATTTATTCTA | No data | ||
| Right | 1028977467 | 7:96930046-96930068 | TCTAAATACCACTTGCGTGGAGG | No data | ||||
| 1028977463_1028977466 | 4 | Left | 1028977463 | 7:96930016-96930038 | CCTGTCTCCCTCTATTTATTCTA | No data | ||
| Right | 1028977466 | 7:96930043-96930065 | TGATCTAAATACCACTTGCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1028977463 | Original CRISPR | TAGAATAAATAGAGGGAGAC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||