ID: 1028977463

View in Genome Browser
Species Human (GRCh38)
Location 7:96930016-96930038
Sequence TAGAATAAATAGAGGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028977463_1028977467 7 Left 1028977463 7:96930016-96930038 CCTGTCTCCCTCTATTTATTCTA No data
Right 1028977467 7:96930046-96930068 TCTAAATACCACTTGCGTGGAGG No data
1028977463_1028977466 4 Left 1028977463 7:96930016-96930038 CCTGTCTCCCTCTATTTATTCTA No data
Right 1028977466 7:96930043-96930065 TGATCTAAATACCACTTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028977463 Original CRISPR TAGAATAAATAGAGGGAGAC AGG (reversed) Intergenic
No off target data available for this crispr