ID: 1028979334

View in Genome Browser
Species Human (GRCh38)
Location 7:96949871-96949893
Sequence ATGTCTCTCTTTCAGTATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028979334_1028979336 16 Left 1028979334 7:96949871-96949893 CCTGCATACTGAAAGAGAGACAT No data
Right 1028979336 7:96949910-96949932 TGAACCACACTTATTTACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028979334 Original CRISPR ATGTCTCTCTTTCAGTATGC AGG (reversed) Intergenic
No off target data available for this crispr