ID: 1028979791

View in Genome Browser
Species Human (GRCh38)
Location 7:96954670-96954692
Sequence CTGCAGTTCTTGAGTGCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028979791_1028979798 18 Left 1028979791 7:96954670-96954692 CCCTATGCACTCAAGAACTGCAG No data
Right 1028979798 7:96954711-96954733 TCAGGCTGTGTTTCATAAACAGG No data
1028979791_1028979797 0 Left 1028979791 7:96954670-96954692 CCCTATGCACTCAAGAACTGCAG No data
Right 1028979797 7:96954693-96954715 GGTTCTTTGGGCAATTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028979791 Original CRISPR CTGCAGTTCTTGAGTGCATA GGG (reversed) Intergenic
No off target data available for this crispr