ID: 1028985794

View in Genome Browser
Species Human (GRCh38)
Location 7:97007101-97007123
Sequence GCTCAGACCAGCCCACGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028985794_1028985796 0 Left 1028985794 7:97007101-97007123 CCTGCTCGTGGGCTGGTCTGAGC 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1028985796 7:97007124-97007146 TGTTGGTTGTGTTTTGTTTGAGG 0: 1
1: 1
2: 12
3: 165
4: 1345
1028985794_1028985798 17 Left 1028985794 7:97007101-97007123 CCTGCTCGTGGGCTGGTCTGAGC 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1028985798 7:97007141-97007163 TTGAGGATTTGGTCCTCCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1028985794_1028985797 6 Left 1028985794 7:97007101-97007123 CCTGCTCGTGGGCTGGTCTGAGC 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1028985797 7:97007130-97007152 TTGTGTTTTGTTTGAGGATTTGG 0: 1
1: 0
2: 0
3: 58
4: 631

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028985794 Original CRISPR GCTCAGACCAGCCCACGAGC AGG (reversed) Intronic
900231391 1:1560365-1560387 GCTCAGTTGAGCCCAGGAGCCGG - Intronic
900246423 1:1638269-1638291 GCACAGACCACTCCACGCGCTGG + Intronic
900257652 1:1705411-1705433 GCACAGACCACTCCACGCGCTGG + Intronic
902876405 1:19343336-19343358 GCCCACCCCAGTCCACGAGCTGG + Intronic
903687135 1:25140123-25140145 GCACACACCACCCCACGGGCAGG + Intergenic
904266389 1:29320627-29320649 GCTCAGCCCAGGCCAGGGGCCGG + Intronic
904576477 1:31508165-31508187 GCTCAGTCCCTCCCACGATCTGG + Intergenic
905259565 1:36707931-36707953 GTTCAGCCCATCCCACGTGCTGG - Intergenic
905359988 1:37412579-37412601 GCTCAGAACAGAGCACAAGCCGG - Intergenic
909716867 1:78718663-78718685 TCTGAGACCAGACCAGGAGCAGG - Intergenic
916576345 1:166070378-166070400 GCTGAGTCCTGCCCACCAGCCGG + Exonic
917348921 1:174056787-174056809 GCTCAGGCCAGCCCAGGAAGAGG + Intergenic
919866480 1:201786855-201786877 GATCAGACCAGTGCAAGAGCAGG + Intronic
922766263 1:228158148-228158170 GCTCAGGCCAGCCGGCGTGCGGG - Exonic
924740559 1:246792131-246792153 TCTCAGACCAGCCCTGGAGTAGG + Intergenic
1062858145 10:789789-789811 GCTCAGACCTCCCCACGCCCCGG - Intergenic
1062925838 10:1314822-1314844 GTTCAGAGCAGCCCAGGTGCAGG - Intronic
1062932018 10:1359799-1359821 TCTCTGACCACCCGACGAGCTGG + Intronic
1063123906 10:3123851-3123873 GCACAGAGCGGCCCAAGAGCTGG + Intronic
1067560348 10:47300667-47300689 GCTCGGACCAGCCCGGGACCCGG + Exonic
1068925458 10:62531480-62531502 CCTCAGACCCGCCCAGCAGCTGG - Intronic
1070467349 10:76736881-76736903 GCTCAGAGCAGCCCAAGCCCTGG - Intergenic
1070786731 10:79166370-79166392 TCTCAGACCCGCCAAAGAGCAGG - Intronic
1075724450 10:124604301-124604323 GCTCAGGCCAGGTCACGGGCTGG + Intronic
1076846658 10:133072490-133072512 GCCCAGACCCGCCCTCCAGCCGG - Intronic
1077020768 11:416267-416289 GCACAGAGCAGCCGCCGAGCCGG - Intronic
1077888401 11:6402486-6402508 GGTCTGACCTGCCCACAAGCAGG - Intronic
1079383075 11:19956071-19956093 ACTGAGACCAGCCCACTGGCTGG - Intronic
1079424535 11:20327568-20327590 GCTCAGGCCTGCTCACCAGCAGG + Intergenic
1083459986 11:62804987-62805009 CATCAGGGCAGCCCACGAGCAGG + Intronic
1084529444 11:69718305-69718327 TCTCACACCAGCCCACGAGGGGG + Intergenic
1085204261 11:74721165-74721187 GCTCTGACCAGCACCCCAGCTGG - Intronic
1085453050 11:76648407-76648429 GCTCAGAGCAGCCTTGGAGCAGG - Intergenic
1092081985 12:5723922-5723944 TCTCAGACCAGTCCCTGAGCCGG - Intronic
1097041803 12:56160448-56160470 GCCCAGCCCAGCCCAGGAGTGGG + Intronic
1104761216 12:131298633-131298655 GCTCAGAGGAGCCCCAGAGCTGG - Intergenic
1104818559 12:131662159-131662181 GCTCAGAGGAGCCCCAGAGCTGG + Intergenic
1105349330 13:19601834-19601856 GCCCAGCCTAGCCCGCGAGCTGG - Intergenic
1107839096 13:44437014-44437036 GGCCAGCCCACCCCACGAGCGGG - Intronic
1108038976 13:46321806-46321828 TCTCAGATCTGCCCACGAGAGGG - Intergenic
1113910237 13:113838269-113838291 GCACAGCCCAGCCCTGGAGCAGG + Intronic
1113910257 13:113838347-113838369 GCACAGCCCAGCCCTGGAGCAGG + Intronic
1113910286 13:113838427-113838449 GCACAGCCCAGCCCTGGAGCAGG + Intronic
1113910300 13:113838466-113838488 GCACAGCCCAGCCCCGGAGCAGG + Intronic
1113910318 13:113838508-113838530 GCACAGCCCAGCCCTGGAGCAGG + Intronic
1113910333 13:113838547-113838569 GCACAGCCCAGCCCCGGAGCAGG + Intronic
1113910350 13:113838589-113838611 GCACAGCCCAGCCCTGGAGCAGG + Intronic
1113910381 13:113838670-113838692 GCACAGCCCAGCCCTGGAGCAGG + Intronic
1113910419 13:113838791-113838813 GCACAGCCCAGCCCTGGAGCAGG + Intronic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1121922605 14:97896860-97896882 CTTCAGAACAGCACACGAGCAGG + Intergenic
1122071722 14:99209439-99209461 CCTCATTCCAGCCCACGACCAGG - Intronic
1126100226 15:45114241-45114263 GCTCAGACCAGCCCCTGGGCTGG + Intronic
1128529951 15:68437998-68438020 TCTCAGCCCAGCCCAGGACCAGG - Intergenic
1129231890 15:74201566-74201588 GCTCAGGCCAGCCCAGGTGAGGG - Intronic
1129331280 15:74828700-74828722 GCTGGGACCAGCCCTCAAGCCGG + Intronic
1132668384 16:1092062-1092084 GCTCCGACCACCCCATGAGGAGG + Intronic
1134548133 16:15125841-15125863 GCTCAGACCTGCTCAGGACCTGG + Intronic
1136392145 16:29972551-29972573 GCTGAGACCAGTTCAAGAGCTGG - Intronic
1139801024 16:69522901-69522923 GCTCAGTTCAGCCCATGGGCTGG + Intergenic
1142262057 16:89047718-89047740 GCTCTGAGCAGCCCAGGAGTGGG + Intergenic
1143239691 17:5433545-5433567 GCTTAGACCAGCCCAGCAGGGGG - Intronic
1143764962 17:9131519-9131541 GCACAGCCCAGCCCTCAAGCAGG - Intronic
1148108005 17:45129750-45129772 CCGCAGCCCAGCCCAGGAGCGGG + Intronic
1151480688 17:74368662-74368684 GACCAGAGCAGCCCACAAGCAGG - Intronic
1151493816 17:74447681-74447703 CCTCAGACAAGCCCAGGTGCGGG - Intronic
1151600662 17:75104259-75104281 TCTCAGCCCAGCCCAGGAGGGGG + Intronic
1151873230 17:76850726-76850748 GCTGAGCACAGCCCAGGAGCTGG + Intergenic
1152467042 17:80472419-80472441 GCTCAGACCAGCCTCCAACCTGG + Intronic
1161010150 19:1955971-1955993 GCTCCGCCCGGCCAACGAGCAGG - Intronic
1161219074 19:3109670-3109692 GCACAGACCACCCCAAGGGCTGG - Intronic
1166837597 19:45677092-45677114 GCTCACCCCAGCCGAGGAGCAGG - Exonic
1168720042 19:58549839-58549861 GCTCTCACCAGCCAACCAGCGGG + Exonic
924979921 2:210254-210276 GGTCAGAACAGCCCAGGAGTAGG + Intergenic
925628845 2:5868559-5868581 GCTCAGAGCAGCCCACACACAGG - Intergenic
927784593 2:25964913-25964935 GCAGAAACCAGCCCAGGAGCTGG - Intronic
934620323 2:95799566-95799588 GCTGAGAGCAGGCCAGGAGCTGG - Intergenic
934640568 2:96024997-96025019 GCTGAGAGCAGGCCAGGAGCTGG + Intronic
937855506 2:126669778-126669800 GCTCAGAAGTGCCCATGAGCGGG - Intronic
945538352 2:211049296-211049318 TCTCAGACCAGCCCAGGTTCAGG - Intergenic
946199984 2:218065742-218065764 TCCCAGACCAGCCCAGGAGGCGG + Intronic
1170945544 20:20888014-20888036 GCTGAGACAATCCCGCGAGCAGG + Intergenic
1173599080 20:44280077-44280099 GGTCAGTCCAGCCCAAGTGCAGG + Exonic
1174071705 20:47904429-47904451 GCAAAGAACAGGCCACGAGCTGG - Intergenic
1174147243 20:48460324-48460346 GCACAGAACAGGCCATGAGCTGG + Intergenic
1174152341 20:48494205-48494227 GCAAAGAACAGGCCACGAGCTGG + Intergenic
1174420851 20:50398391-50398413 GCTGAGTCCAGCCCACAAGCAGG + Intergenic
1176094406 20:63333311-63333333 GCTCAGGCCAGCCACCGAGGTGG + Intronic
1179202363 21:39236452-39236474 GCCCAGACCAGCCCCAGAGCAGG + Intronic
1182348864 22:29687116-29687138 ACTCAGACCAGCTCAGGATCGGG - Intronic
1182550538 22:31098683-31098705 GACCAGGCCAGCCCACGGGCCGG + Exonic
1182652840 22:31866069-31866091 GCTGTGACAAGCCCACGAGGTGG + Intronic
1182713050 22:32334523-32334545 GCTCACAGCAGCCAACCAGCAGG - Intergenic
1184384599 22:44167051-44167073 CTTCAGACCCGCCCACGTGCAGG - Intronic
1184429073 22:44430698-44430720 GCTCCTACCAGCCCACCAGGAGG + Intergenic
950153711 3:10707584-10707606 GCTCGGAGCAGCCCCGGAGCTGG - Intronic
950490838 3:13303996-13304018 GCTCAGACCAGGGCCAGAGCGGG - Intergenic
952796394 3:37243053-37243075 GTTCAGACTAGCCCACGCTCCGG + Intergenic
961361628 3:126371603-126371625 GCTCACACCACCGCAGGAGCCGG - Intergenic
968512569 4:1002092-1002114 GCAGGGACCAGCCCACCAGCGGG - Exonic
968894458 4:3390569-3390591 GCGCAGAGCAGCCCAGGAGGAGG - Intronic
969433174 4:7167941-7167963 ACTCAGGCCAGGCCACGAGAGGG - Intergenic
975526617 4:75357822-75357844 GCTCAATCCAGCCCACCACCTGG + Intergenic
977817741 4:101434743-101434765 ACCCAGACCAACCCACCAGCTGG + Intronic
978377234 4:108087739-108087761 TCTCAGACCAGCATCCGAGCAGG - Intronic
985542898 5:495033-495055 CCTCAAAGCAGCCCACGTGCCGG - Intronic
985868728 5:2537108-2537130 CGTCAGCACAGCCCACGAGCTGG - Intergenic
997262207 5:132473941-132473963 GCTGAGTCCAACCCACGTGCAGG + Intronic
998039692 5:138944468-138944490 GGTCAGCCCAGCCCAGGAGCAGG + Intergenic
1017822539 6:158059995-158060017 TCTCAGTCCAGCCCAGGAGCAGG + Intronic
1018812062 6:167305486-167305508 CCTCAGAGCAGCCCAGCAGCCGG - Intronic
1019184304 6:170212247-170212269 GCCCAGACCAGCCAACCAGGAGG + Intergenic
1019417061 7:932634-932656 GCTCAGACAAGCCCACAGCCTGG + Intronic
1022032299 7:26503591-26503613 GCTCAGAACAGGCAAAGAGCTGG - Intergenic
1025234743 7:57227083-57227105 GCAAAGAACAGGCCACGAGCTGG - Intergenic
1025249976 7:57345078-57345100 GCTGAGTCCAACCCACAAGCGGG - Intergenic
1028985794 7:97007101-97007123 GCTCAGACCAGCCCACGAGCAGG - Intronic
1029640529 7:101816728-101816750 GCTCTGACCCTCCCCCGAGCCGG - Intronic
1034328782 7:150264066-150264088 GCACACACCACCCCACGAGTAGG + Intronic
1034669266 7:152845685-152845707 GCACACACCACCCCACGAGCAGG - Intronic
1036432253 8:8702116-8702138 GGTCAGACCCGCCCGCGGGCTGG + Exonic
1038583482 8:28769994-28770016 GGCCCGCCCAGCCCACGAGCGGG - Exonic
1039572989 8:38602050-38602072 GCTCTCACCAGCCCAGGAGGAGG - Intergenic
1047214788 8:122867343-122867365 GCTCAGCCCAGCTCACCAACTGG + Intronic
1050462514 9:5888959-5888981 TCTCAGACCAGCCACTGAGCTGG - Intronic
1051603867 9:18900843-18900865 GCACAGACCATCCCATCAGCTGG - Intronic
1056905397 9:90642975-90642997 GCTCAGGCCAGCGCAGGTGCAGG - Exonic
1057075529 9:92136366-92136388 GCTCAGCTCTGCCCACGAACAGG - Intergenic
1057140950 9:92726515-92726537 GCTCAGACCAGCAGAACAGCAGG + Intronic
1061232853 9:129325019-129325041 GCACAGACCTGCCCACAAGTGGG - Intergenic
1061251226 9:129427669-129427691 GCTAAGACCATCCCAGGCGCCGG - Intergenic
1061700244 9:132410230-132410252 GCCCAAACCAGCCCGCGGGCCGG + Exonic
1062152408 9:135028341-135028363 GCTCTGCCCAGCCCACATGCTGG - Intergenic
1185786030 X:2891677-2891699 GTTCAGAATAGCCCATGAGCTGG - Intergenic
1200164494 X:154026835-154026857 GCTATGACAAGCCCACCAGCAGG + Intronic