ID: 1028987180

View in Genome Browser
Species Human (GRCh38)
Location 7:97017738-97017760
Sequence TGCGATGTCAAGAGTGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028987174_1028987180 7 Left 1028987174 7:97017708-97017730 CCGGAAGGGGCAGGCAGAGGGGT No data
Right 1028987180 7:97017738-97017760 TGCGATGTCAAGAGTGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028987180 Original CRISPR TGCGATGTCAAGAGTGGGGC CGG Intergenic
No off target data available for this crispr