ID: 1028987400

View in Genome Browser
Species Human (GRCh38)
Location 7:97018849-97018871
Sequence CGCTGGGGGTGCCGGAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028987384_1028987400 30 Left 1028987384 7:97018796-97018818 CCGAGAAAGTACGGCTGGAGCGG No data
Right 1028987400 7:97018849-97018871 CGCTGGGGGTGCCGGAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028987400 Original CRISPR CGCTGGGGGTGCCGGAGGAG GGG Intergenic
No off target data available for this crispr