ID: 1028987667

View in Genome Browser
Species Human (GRCh38)
Location 7:97021113-97021135
Sequence CGCCGCCCCGGGGAAGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 251}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028987667_1028987677 3 Left 1028987667 7:97021113-97021135 CCCGCGCCTTCCCCGGGGCGGCG 0: 1
1: 0
2: 0
3: 16
4: 251
Right 1028987677 7:97021139-97021161 GGAGGCATCTTCGGACCTCTGGG 0: 1
1: 0
2: 1
3: 3
4: 68
1028987667_1028987678 6 Left 1028987667 7:97021113-97021135 CCCGCGCCTTCCCCGGGGCGGCG 0: 1
1: 0
2: 0
3: 16
4: 251
Right 1028987678 7:97021142-97021164 GGCATCTTCGGACCTCTGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 289
1028987667_1028987675 -6 Left 1028987667 7:97021113-97021135 CCCGCGCCTTCCCCGGGGCGGCG 0: 1
1: 0
2: 0
3: 16
4: 251
Right 1028987675 7:97021130-97021152 GCGGCGACTGGAGGCATCTTCGG 0: 1
1: 0
2: 0
3: 6
4: 77
1028987667_1028987680 21 Left 1028987667 7:97021113-97021135 CCCGCGCCTTCCCCGGGGCGGCG 0: 1
1: 0
2: 0
3: 16
4: 251
Right 1028987680 7:97021157-97021179 CTGGGCGGCCCAGCCCTGCCTGG 0: 1
1: 0
2: 3
3: 62
4: 478
1028987667_1028987676 2 Left 1028987667 7:97021113-97021135 CCCGCGCCTTCCCCGGGGCGGCG 0: 1
1: 0
2: 0
3: 16
4: 251
Right 1028987676 7:97021138-97021160 TGGAGGCATCTTCGGACCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028987667 Original CRISPR CGCCGCCCCGGGGAAGGCGC GGG (reversed) Intronic
900314444 1:2050116-2050138 CGGCGCCCCCGGGAACTCGCTGG - Intergenic
900513353 1:3070368-3070390 CGCCTCACCGCGGATGGCGCCGG - Intronic
900599678 1:3497667-3497689 CCCCGCCCCATGGAAGGCGAAGG + Intronic
900804785 1:4760541-4760563 CCCCGCCCCTGGGATGGCCCAGG + Intronic
901483079 1:9539510-9539532 GGCCACGCCGCGGAAGGCGCGGG + Exonic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
902586227 1:17439904-17439926 CGCGGGCCCGCGAAAGGCGCAGG - Intergenic
902813576 1:18903118-18903140 CGCAGCCCCCGGGAAGAAGCAGG - Intronic
903750323 1:25617173-25617195 CTCCGCCGCGGAGAGGGCGCCGG - Intergenic
903774477 1:25783803-25783825 CGCCGCCCTGGGGCCGCCGCAGG + Exonic
905043200 1:34976947-34976969 CGCCAGCCAGGCGAAGGCGCAGG + Intergenic
905580748 1:39081533-39081555 CGGCTCCCAGGGTAAGGCGCGGG + Intronic
906276865 1:44523293-44523315 GGCTGCCCCGGGGAAGGGTCTGG + Intronic
906637006 1:47416478-47416500 CGCCGCCCCGGGCCGGGCGCGGG - Exonic
908534768 1:65067175-65067197 CGCCACCTCGGGGTAGGCGGCGG - Intergenic
912413625 1:109494028-109494050 CTCCTCCCCGGGGACGCCGCCGG - Intergenic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
919739258 1:200972490-200972512 CAGCGCCCCCGGGAAGGCGGGGG - Intronic
919826475 1:201506959-201506981 CGCAGCCCCGGGGCTGTCGCAGG - Intronic
922461542 1:225817458-225817480 CTCCTCCCTGGGGAAGGCGAAGG - Intronic
922766411 1:228158708-228158730 GGCCGCCGCAGGGAAGGCGCAGG - Exonic
923684032 1:236142133-236142155 CGCGGCCCCGGGGATGGGGAAGG + Intergenic
923684083 1:236142250-236142272 CGCGGCCCCGGGGATGGGGAGGG + Intergenic
1062889600 10:1048647-1048669 CCGCGCCCCGTGGAAGGCGGAGG - Intronic
1063504013 10:6580170-6580192 CGCCGCCGCCGGGAGGGAGCGGG - Intronic
1064028794 10:11869976-11869998 CCCCGCGGCGGGGAAGGCGCCGG - Exonic
1064156937 10:12909991-12910013 CGCCCTCCCGGGGAATGCGATGG + Intronic
1065660276 10:27998913-27998935 CGGCGCCCGGGGGAGGGCACGGG - Intronic
1066126574 10:32347597-32347619 CGTGGCCCCGGGGCAGCCGCTGG - Intronic
1067085114 10:43234065-43234087 TGCTGCCCTGGGGAAGGGGCTGG + Intronic
1068955218 10:62815137-62815159 CCCGGCCTCGAGGAAGGCGCGGG + Intronic
1068989189 10:63133554-63133576 CGACGCGCCGGGGACGGGGCCGG - Intronic
1069386110 10:67884753-67884775 CGCCGCCGAGGGGGAGCCGCCGG - Exonic
1072059744 10:91798479-91798501 CGCCGCCGCGGGGCAGCCGGGGG + Exonic
1073325570 10:102642667-102642689 CGCCGCCGCGAGGAAGGCGGCGG - Intergenic
1074863981 10:117534692-117534714 CGCCGCCCCCGGCAAGCTGCTGG + Intergenic
1075079048 10:119370573-119370595 GCCCGCCCCTTGGAAGGCGCAGG - Intronic
1075207065 10:120457150-120457172 CGCCGGGCGGGGGCAGGCGCCGG - Exonic
1076821562 10:132942391-132942413 CCCCGCCCCGGGGAGGCCCCGGG - Intronic
1076991978 11:280202-280224 CGCCGCCCCGGAGGAGGCGATGG + Exonic
1076992102 11:280718-280740 CGCCGCCCCCGGGAGGCTGCAGG + Exonic
1077043099 11:533176-533198 CACAGCTCCGGGGAAGGCGGAGG - Intronic
1077093556 11:790034-790056 CGCAGCCCCGGGGAGGCCGGAGG - Exonic
1077444873 11:2586262-2586284 CGCTGCCCCAGGCAAGGCCCAGG + Intronic
1077916066 11:6612151-6612173 CGCCGCCTCGGGGTCCGCGCCGG + Exonic
1081636901 11:44727361-44727383 CGCCGCCCCGGGGGTGCTGCTGG + Intronic
1082028610 11:47589574-47589596 CGCAGGCCCGGGGAAGGGGTTGG - Intergenic
1082206002 11:49434599-49434621 GGCCACGCCGCGGAAGGCGCGGG - Intergenic
1084162272 11:67356351-67356373 CTCAGCCCCTGGGAAGGTGCCGG - Intronic
1084304409 11:68272114-68272136 CGCCTCCCCGGGGCCGGCTCGGG + Intergenic
1084526800 11:69703199-69703221 CTCCGCCCGGGGACAGGCGCCGG + Intronic
1086064903 11:82733799-82733821 CGCCGCGCCGGGGCGGGAGCTGG - Exonic
1087118124 11:94545031-94545053 CGCAGCCCCGGGGAGTGCGAGGG - Exonic
1087634538 11:100687566-100687588 CGCGATCGCGGGGAAGGCGCCGG - Intergenic
1089520103 11:119057423-119057445 GGTCGCCCCGGGGCCGGCGCTGG - Intergenic
1089543579 11:119206009-119206031 CCCCGCCCCGGCGTAGGGGCGGG + Intergenic
1090978391 11:131695037-131695059 CGCCGCCGCCGGGAGGGTGCAGG + Intronic
1091563280 12:1630230-1630252 CGGGGCCCCGGGGAGGCCGCTGG + Intronic
1091613981 12:2035148-2035170 CGGCGCCCCGCGGAGGGCCCGGG - Intronic
1092247942 12:6873597-6873619 CGCCCCCACGGCGAAGGCCCGGG + Intronic
1094317463 12:29149338-29149360 CGTAGCCTCGGGGAAGGAGCAGG + Exonic
1094607328 12:31959734-31959756 CGCCGCACCGGGGCCGGCCCTGG + Intronic
1096493009 12:52023298-52023320 CGCGGCCCCGGGGTGGGCGAGGG - Intronic
1098218789 12:68246540-68246562 CGCCAGCCCAGGGAAGGGGCAGG + Intergenic
1101446042 12:104737638-104737660 CACTGCCCCGAGGAAGGCACTGG - Intronic
1103309021 12:119989687-119989709 CGCCGGCGCGGGGGAGGGGCGGG + Intergenic
1104626014 12:130355431-130355453 CGCCGTCAGGGTGAAGGCGCTGG - Intronic
1104904393 12:132205567-132205589 CACCATCCCGGGGAAGGAGCCGG - Exonic
1104989743 12:132618858-132618880 AGCAGCCCCGGGCCAGGCGCCGG - Exonic
1108618627 13:52159584-52159606 GCCCGCCCCGCGGAAGCCGCCGG - Exonic
1110436399 13:75481873-75481895 CGCCGCTCCCAGGCAGGCGCGGG - Exonic
1110705936 13:78602172-78602194 GGCGGCCCCGGGGGAGGCGGCGG - Exonic
1117392093 14:55271712-55271734 AGCCGCACCGGAGGAGGCGCAGG - Intronic
1117424615 14:55580808-55580830 CTCCGGCCCGGGGACGCCGCCGG - Intronic
1117549096 14:56816762-56816784 CGCCGCCCCGCTGGAGGCGCCGG + Intergenic
1118192648 14:63594480-63594502 CTCCACCCTGGGGAAGGCCCTGG - Intergenic
1119522156 14:75294334-75294356 CGCCGGCCCGGGGTAGGCTGTGG + Intergenic
1119704984 14:76777851-76777873 GGCTGCCCTGGGGAAGGCCCGGG - Intronic
1120905689 14:89619173-89619195 CGCCGACCCCGGGCGGGCGCCGG - Intergenic
1121473425 14:94174185-94174207 CGCGGCGCCCGGGAAGGGGCGGG + Intronic
1121671599 14:95714378-95714400 CGGGGCCTCGAGGAAGGCGCGGG - Intergenic
1121710987 14:96039238-96039260 CCCCGCCCCGGGGGTGGGGCGGG + Intergenic
1122131183 14:99605082-99605104 CGCCGCTCCGGGCAGGGGGCAGG - Intergenic
1122905694 14:104800590-104800612 CGCCCCGGCGGGGAGGGCGCGGG - Intronic
1125594236 15:40874069-40874091 CGCCGCCGCGGGGGAGGGGTCGG + Exonic
1125674252 15:41494071-41494093 CGCCGCCGCGGGGGAGCCCCGGG + Exonic
1126109501 15:45167293-45167315 CGTCAGCCCGGGGACGGCGCCGG + Exonic
1126849910 15:52790497-52790519 CAGCGCCGCAGGGAAGGCGCTGG - Intronic
1129109797 15:73330694-73330716 CAGCCCCCAGGGGAAGGCGCAGG + Intronic
1131153181 15:90059626-90059648 CGCCGGCACGGGGGAGGGGCAGG - Intronic
1132779270 16:1614101-1614123 CCCCGCCCCCCGAAAGGCGCGGG - Intronic
1133225838 16:4339992-4340014 CGCCACCCCGTGGGAGGGGCAGG + Intronic
1136365136 16:29806309-29806331 CGGCGCCTCGGGGAGGGCGGGGG - Intronic
1136497156 16:30651535-30651557 CGGAGCCCCAGGGAAGGGGCCGG + Exonic
1136498732 16:30659322-30659344 TGTCGCCCCGGGGGCGGCGCCGG + Exonic
1139882738 16:70188308-70188330 CGCGGCCCCGGCCAAGGGGCGGG - Intergenic
1140369772 16:74407211-74407233 CGCGGCCCCGGCCAAGGGGCGGG + Intergenic
1141665435 16:85463060-85463082 CGCGGCCCGGGGGGCGGCGCAGG + Intergenic
1142271806 16:89093834-89093856 CGCCGCGCCGGGGAAGCTGTTGG + Exonic
1142471824 17:168969-168991 AGCGGCCCCGGGGGAGGCCCTGG + Intronic
1142863408 17:2776815-2776837 CGCCGCCCCGGAGGAGGAGGAGG + Intergenic
1143174620 17:4948990-4949012 CCCGGCCCCGGCGCAGGCGCAGG - Exonic
1143448812 17:7023683-7023705 CGCCGCCCCGGAGGGAGCGCTGG + Exonic
1145041373 17:19580158-19580180 CGCCGCGCAGGGGTGGGCGCGGG + Intergenic
1146911975 17:36654020-36654042 TGCCGCACCAGGGGAGGCGCAGG + Intergenic
1147200709 17:38799608-38799630 CCCCGCCCCGGGGAGCCCGCCGG + Exonic
1147400673 17:40178371-40178393 CGCCGCCTCAGGTAAGGAGCCGG + Intronic
1147440240 17:40443379-40443401 CCCCACCTCTGGGAAGGCGCTGG + Intergenic
1148206971 17:45785033-45785055 CGCCGCGGAGGGGAAGGGGCAGG - Intronic
1152425152 17:80214577-80214599 GGCCGCCAGGGGGAAGGGGCAGG + Intronic
1152811971 17:82386521-82386543 AGCTGCCCAGGGGAAGGCGGAGG - Intergenic
1152879170 17:82805555-82805577 TGCTTCCCCAGGGAAGGCGCTGG + Intronic
1152952843 18:11075-11097 CGCAGCGCCGGCGCAGGCGCAGG + Intergenic
1152952851 18:11110-11132 CGCAGCGCCGGCGCAGGCGCAGG + Intergenic
1153226765 18:2906195-2906217 CGGCCCTCTGGGGAAGGCGCCGG - Intronic
1153480615 18:5543455-5543477 CACCTCCCCGGGGGAGGGGCCGG + Intronic
1156411186 18:36829225-36829247 CGCCGTCCCGTGGAGGGCGCCGG - Intronic
1157856620 18:51110448-51110470 CCCCAGCCCGGGGCAGGCGCTGG - Intergenic
1160567767 18:79797950-79797972 CTCCGCCCCGAGGAGGCCGCCGG + Intergenic
1160779045 19:869696-869718 CCCTGCTCCGGGGAAGGCCCCGG - Intronic
1161545447 19:4877829-4877851 CGCTGCCCCCTGCAAGGCGCTGG + Intergenic
1161952866 19:7477412-7477434 CGCTGCCCCGGGGCAAGCGGAGG - Exonic
1162372973 19:10290021-10290043 CGCCGCGGCGGGGAAAGCACAGG - Exonic
1162372982 19:10290047-10290069 CGCAGCCCTGGCGAAGGCCCTGG - Exonic
1162412947 19:10517455-10517477 CGCCGCTCCGGGGGCGGGGCTGG + Intronic
1162470999 19:10871930-10871952 CGGGGCCCCGGGGCAGGCGCAGG + Intronic
1163662999 19:18589566-18589588 CGCCGCCTCGCGGGAGGTGCTGG + Exonic
1166361316 19:42254028-42254050 CGCCGCCCCCGGGCTCGCGCGGG - Intronic
925358944 2:3263702-3263724 CCGCGTCCTGGGGAAGGCGCTGG - Intronic
927215502 2:20666208-20666230 CCCCGCCGCGGTGATGGCGCGGG - Intergenic
930700862 2:54456814-54456836 CGCCGCGCCGGGGCTGGGGCCGG - Intronic
932102194 2:68911463-68911485 CCCCTCCCCGTGGAAGGCACAGG - Intergenic
933847582 2:86337815-86337837 CGGTGCCCCGGGGAGCGCGCAGG - Intronic
935692581 2:105744765-105744787 CGCCGCCCAGGGGCCGGCCCAGG - Intergenic
935914873 2:107938363-107938385 CACCGCCCTGGGGATGGGGCAGG + Intergenic
936278637 2:111120460-111120482 AGCCGCTCTGGGGCAGGCGCGGG - Intronic
937951083 2:127388193-127388215 GGCTGCCCCGGGGCAGGGGCGGG - Intronic
942276407 2:174326836-174326858 CGCCGACCTGGGGGAGGCGGAGG - Intergenic
942642187 2:178072164-178072186 CCCCGCCACCGGGAAGGGGCTGG + Exonic
945148708 2:206765326-206765348 CGCAGCCAAGGGCAAGGCGCAGG + Exonic
947119443 2:226799911-226799933 CGCTGCGCCGGGGTCGGCGCGGG - Intergenic
947545394 2:231006943-231006965 GGGGCCCCCGGGGAAGGCGCTGG + Intronic
948420806 2:237859199-237859221 CTCCGCCCAGGTGCAGGCGCTGG - Intronic
948874702 2:240820360-240820382 GGCCGCCGCGGGGATGGGGCTGG + Intergenic
948908491 2:240991341-240991363 GGCGGCCCTGGGGAAGGTGCTGG + Intronic
1170629651 20:18056500-18056522 CGCCGCCCAGGGGCAGGTGCAGG + Intronic
1170924786 20:20712714-20712736 CCCCGCCCCGCGGGAGGTGCCGG + Intergenic
1171010172 20:21505373-21505395 CGCCGCCCCGCGGAAAGCCTGGG + Intergenic
1171405463 20:24909667-24909689 AGCCCCCCTGGGGAAGGAGCAGG - Intergenic
1171778379 20:29393267-29393289 CTCGGCCCCGAGGAAGGGGCTGG + Intergenic
1172838306 20:37886919-37886941 GGCTGGGCCGGGGAAGGCGCTGG + Intergenic
1173792090 20:45834247-45834269 CGCCTCCCCGGGGCCGTCGCCGG - Exonic
1173813579 20:45971260-45971282 GGCCGCCCCGGGGCAGGCAGAGG - Exonic
1174607039 20:51768462-51768484 CGCCGCCCCGGGGGAGGAGGCGG + Exonic
1174658601 20:52191851-52191873 CGGCTCCCCGGGGAAGCGGCGGG + Exonic
1176106585 20:63392381-63392403 CGCCACCCCTGAGAAGGCACAGG + Intergenic
1176162056 20:63653109-63653131 CGCCGCGCCGGGGAGCGCTCGGG - Intronic
1176869084 21:14072462-14072484 CGACGCCCCGGGCCTGGCGCAGG + Intergenic
1177833821 21:26169663-26169685 CGCAGCCCCGGGAAGGGAGCCGG + Intronic
1179504694 21:41832774-41832796 TGCCGCCCCGTGGAAGGCAATGG + Intronic
1179522529 21:41954180-41954202 CGCGGCCCGCGGGCAGGCGCCGG - Intergenic
1179605563 21:42513608-42513630 CTCGGAGCCGGGGAAGGCGCGGG + Intronic
1179674938 21:42974817-42974839 CGCCGCCCGGGGCAGGGGGCGGG + Intronic
1179810306 21:43865513-43865535 CGCGGGGCCTGGGAAGGCGCGGG + Intronic
1180801587 22:18634480-18634502 CGCGGCGCGGGGGACGGCGCGGG - Intergenic
1180852830 22:19030019-19030041 CGCGGCGCGGGGGACGGCGCGGG - Intergenic
1180953502 22:19731204-19731226 CACCGCCGCGGGGGAGGGGCGGG + Intergenic
1180968334 22:19802036-19802058 AGGCTCCGCGGGGAAGGCGCTGG - Exonic
1182261194 22:29073658-29073680 CCCGGCCCGGGGGAAGTCGCTGG - Intronic
1182532299 22:30969620-30969642 CCCCGCTCCGGGGGAGGCGGCGG + Intergenic
1183050585 22:35257729-35257751 AGCCGCCCCCAGGAAGGGGCTGG + Intronic
1183439515 22:37815466-37815488 CTCCACCCTGGGGAAGGCCCTGG + Exonic
1183513581 22:38250160-38250182 CGCCGCACCCAGGAAGGCCCAGG - Intronic
1184112237 22:42402150-42402172 GGAAGCCCCGGGGAAGGGGCTGG + Intronic
1185335852 22:50270539-50270561 CGCCCCCCCCGGGAAGGGGAGGG - Intronic
1185337212 22:50276049-50276071 GGCCTCCCCGGGGAAGCAGCTGG + Intronic
951544466 3:23810761-23810783 CGCCGCGCCGGTGAAGTTGCGGG - Intronic
951558948 3:23946376-23946398 AGGCGCCTCGGGGAAGGCGTGGG + Intronic
951907834 3:27721695-27721717 CACAGCCGCGGGGAAGCCGCCGG + Exonic
954664781 3:52245943-52245965 GGCCGCCCCGGGGCTGGAGCTGG - Intronic
954959310 3:54550359-54550381 CACAGCTCCGGGGAAGGCCCAGG - Intronic
959085603 3:101849013-101849035 CGCCGCGCCGGGGCAGGCAGAGG + Intronic
961182575 3:124887658-124887680 CGTCGCCACGGGAAAGGGGCGGG + Intronic
961202437 3:125055669-125055691 CGCCGCCCCGGGAGCGCCGCGGG - Exonic
961202467 3:125055772-125055794 CGGCGAGCCGGGGAAGGCGGCGG + Exonic
961551622 3:127673092-127673114 CGCAGTCCCGGGGAGGGTGCGGG + Intronic
968093049 3:195909777-195909799 CGCCGCCCCGGGGTGGGGGGTGG + Intronic
968522734 4:1041404-1041426 CACCCCCCGGGGGGAGGCGCTGG + Intergenic
968660136 4:1795422-1795444 CGCCGCCCCGGGGGAGGGGTGGG - Intronic
968674704 4:1871319-1871341 CGCCGCCTCGCAGAAGCCGCGGG - Intergenic
968850451 4:3074468-3074490 CCCCACCCGGGCGAAGGCGCGGG - Intergenic
971018860 4:22515257-22515279 CGCTGCGCCGGGGACAGCGCGGG + Intronic
972396854 4:38664760-38664782 CGCCGTCCCGGGCAGGGCGCGGG + Intronic
973317828 4:48780013-48780035 TCCAGCCCCGGGGCAGGCGCCGG - Intronic
975701900 4:77075372-77075394 CGCTGCCACGGGGGCGGCGCGGG + Intronic
978127165 4:105147828-105147850 CGCAGGCCCGGGGAGGGGGCGGG + Intronic
978741906 4:112145940-112145962 CGCGACCCCGGGGCCGGCGCTGG - Intronic
979205535 4:118033545-118033567 GCCCGCCCCGGGGAAGGGGAGGG - Intergenic
981528722 4:145732894-145732916 GGGAGCCCCGGGGAAGGCGCAGG + Intronic
984462981 4:180059123-180059145 CGCCGCCTCGCCAAAGGCGCTGG - Intergenic
985539947 5:483194-483216 CACCGTCTCCGGGAAGGCGCAGG - Intronic
985573529 5:663331-663353 CACCGGCCTGGGGAAGGCGGGGG - Exonic
985783322 5:1881966-1881988 CGCCGCCTCGGCCCAGGCGCCGG - Exonic
987193195 5:15500233-15500255 GCCCTCCCCGGGGAAGCCGCGGG + Exonic
992591101 5:78295903-78295925 GGCCGCCCCAGGGAAGGCGGTGG + Intergenic
994710432 5:103258853-103258875 CGCAGCCCCGGGCACGGCGGAGG + Exonic
998208367 5:140175426-140175448 CGCAGCCCCTGGGGAGGGGCAGG + Intronic
1000052756 5:157576143-157576165 CGGCCCCCGGGGGACGGCGCTGG - Intergenic
1002306496 5:178286775-178286797 TGCTGCCCCGGGGGAGGGGCAGG - Intronic
1002896205 6:1381987-1382009 CGCCACCCCGCGGAAGCCGGAGG + Intergenic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006634514 6:35452447-35452469 CGCCGCGTCAGGGACGGCGCTGG + Exonic
1006717711 6:36130817-36130839 GGTGGCCCCGGGGAGGGCGCTGG - Intronic
1007952925 6:45888134-45888156 CCCCACCCCAGGGAAGGGGCAGG - Intergenic
1011640379 6:89412008-89412030 GGCCGGCCCGGGGACGGCGGGGG + Exonic
1014947577 6:127516021-127516043 CGCCGCCCAGGGGCTGGCGAGGG - Exonic
1016330539 6:142947581-142947603 CTCCGCCCCGGGCAGGGCGGCGG - Intergenic
1016433137 6:144008419-144008441 CGCGGCCGCGAGGAGGGCGCTGG + Intronic
1016597009 6:145814552-145814574 CGCCGCAGCGCGGACGGCGCCGG + Intronic
1018733296 6:166669256-166669278 GGCAGCCCGGGGGAAGGAGCAGG - Intronic
1019405627 7:882531-882553 CCTTGCCCCGGGGATGGCGCGGG + Intronic
1019405652 7:882605-882627 CCTTGCCCCGGGGATGGCGCGGG + Intronic
1019405666 7:882642-882664 CCTTGCCCCGGGGATGGCGCGGG + Intronic
1019405680 7:882679-882701 CCTTGCCCCGGGGATGGCGCGGG + Intronic
1019531274 7:1504564-1504586 CGGCGGCGCGGGGCAGGCGCTGG + Intergenic
1019545262 7:1571098-1571120 CCCCACCCCGAGGAAGGCTCTGG - Intergenic
1019989588 7:4682400-4682422 TGCGGCCGCGGGGAAGGCGGCGG - Exonic
1022088140 7:27088410-27088432 AGCCGGCCGGGGGCAGGCGCTGG + Intergenic
1022164020 7:27740293-27740315 GGCCGCCCCGCACAAGGCGCTGG - Intronic
1022714963 7:32891311-32891333 CGCCGCCCTGGGGCCGCCGCGGG + Intronic
1024612975 7:51083087-51083109 AGCTTTCCCGGGGAAGGCGCTGG - Intronic
1024920271 7:54546706-54546728 GACAGCCCCGGGGAAAGCGCGGG + Intronic
1026360807 7:69599527-69599549 CTCCGCCCCGAGGAGGGCGCGGG - Exonic
1026837393 7:73647873-73647895 CGCCCGCGCGGAGAAGGCGCCGG - Intergenic
1026953807 7:74364408-74364430 GGCCCCCCCGGGGAAGGGGCTGG + Intronic
1026968595 7:74454707-74454729 CCCGGCCCCGGGGAGGGGGCTGG + Intronic
1028987667 7:97021113-97021135 CGCCGCCCCGGGGAAGGCGCGGG - Intronic
1029782539 7:102749370-102749392 CGGCGCCCCGGGCCAGGCGGAGG - Exonic
1036454060 8:8892927-8892949 CCCGGCCCCGGGGCAGGCCCCGG + Exonic
1036767932 8:11560709-11560731 TGCCCCCACGGGGCAGGCGCTGG + Intronic
1041689783 8:60678299-60678321 CGCCGCCCCGGGGCAGGAAGCGG - Intergenic
1043502940 8:80874250-80874272 CGCCGCCCCGCCGTAGCCGCCGG - Intronic
1049182360 8:141229478-141229500 CCCCTACCCGGGGAAGGCACTGG - Intronic
1049471209 8:142775776-142775798 CCCTGCCCCGGGGAAGGTGACGG - Intronic
1049508998 8:143018471-143018493 CGCGGCCCCGGGGCGGGGGCAGG - Intronic
1049557403 8:143289808-143289830 CTCCGCCCGGGGTAAGGAGCCGG + Intronic
1052824897 9:33167377-33167399 CGGGGCCCCGGCGAAGGCGGGGG + Intergenic
1053593250 9:39534118-39534140 TGCCGGCCCCGGGAAGGGGCAGG + Intergenic
1053850984 9:42288826-42288848 TGCCGGCCCCGGGAAGGGGCAGG + Intergenic
1054573056 9:66831159-66831181 TGCCGGCCCCGGGAAGGGGCAGG - Intergenic
1060974151 9:127754927-127754949 GGCCGACCCGGGGAGGGGGCGGG - Intronic
1061400985 9:130368281-130368303 CCCCTCCCCGGGGAGGGGGCTGG + Intronic
1061624876 9:131835708-131835730 CCCAGCCTCTGGGAAGGCGCAGG + Intergenic
1061975949 9:134068110-134068132 GGCCGCCCAGGGGAGGCCGCGGG + Intronic
1062120749 9:134832817-134832839 CCTCGCCCCTGGGAAGGCCCAGG + Intronic
1062310222 9:135931423-135931445 CGCAGCCCCTGGGAAGGCCTCGG + Intergenic
1062346722 9:136118485-136118507 CGCCGCCGCGGAGAGGGCACCGG - Exonic
1062537793 9:137028426-137028448 CGCCGCCGCCGGGAAGCCTCCGG + Intronic
1187281510 X:17861112-17861134 CGCCGCCTCCAGGAAGCCGCGGG + Exonic
1187507291 X:19887805-19887827 GGCCGCGTCGGGGCAGGCGCCGG + Intergenic
1191129781 X:56995451-56995473 CGCCGCCACCAGGAAGGCGGAGG - Exonic
1191253794 X:58271234-58271256 CCCCCCCCCGGGTCAGGCGCAGG + Intergenic
1192657089 X:73003384-73003406 GGCCACCCCGGGGGAGGCGGAGG + Intergenic
1192665031 X:73079617-73079639 GGCCACCCCGGGGGAGGCGGAGG - Intergenic
1200100655 X:153687995-153688017 CGCCGCCGCCGGGAAGGAGAGGG + Intronic
1200163336 X:154020013-154020035 CCCCGCGCCGGGGAGGGCCCGGG + Intergenic