ID: 1028989871

View in Genome Browser
Species Human (GRCh38)
Location 7:97037216-97037238
Sequence TAGCCTATCCTCAGTAGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028989865_1028989871 28 Left 1028989865 7:97037165-97037187 CCTGGTTAGCAAAGCTTAGGTTT No data
Right 1028989871 7:97037216-97037238 TAGCCTATCCTCAGTAGGTTAGG No data
1028989869_1028989871 -5 Left 1028989869 7:97037198-97037220 CCTTGGGGTTGACTTACATAGCC No data
Right 1028989871 7:97037216-97037238 TAGCCTATCCTCAGTAGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028989871 Original CRISPR TAGCCTATCCTCAGTAGGTT AGG Intergenic
No off target data available for this crispr