ID: 1028995293

View in Genome Browser
Species Human (GRCh38)
Location 7:97093310-97093332
Sequence CCCCCACACTCCCCTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028995293_1028995296 2 Left 1028995293 7:97093310-97093332 CCTGCCTCAGGGGAGTGTGGGGG No data
Right 1028995296 7:97093335-97093357 GTTCTATCATTACCAGTTCTTGG No data
1028995293_1028995298 23 Left 1028995293 7:97093310-97093332 CCTGCCTCAGGGGAGTGTGGGGG No data
Right 1028995298 7:97093356-97093378 GGCACAAAGCTCTGAAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028995293 Original CRISPR CCCCCACACTCCCCTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr