ID: 1029007721

View in Genome Browser
Species Human (GRCh38)
Location 7:97228069-97228091
Sequence TCTCAGGCCCCTCATTTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029007718_1029007721 2 Left 1029007718 7:97228044-97228066 CCTGGAACTTGGTAGAAATGCAT No data
Right 1029007721 7:97228069-97228091 TCTCAGGCCCCTCATTTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029007721 Original CRISPR TCTCAGGCCCCTCATTTTAA GGG Intergenic
No off target data available for this crispr