ID: 1029012299

View in Genome Browser
Species Human (GRCh38)
Location 7:97274450-97274472
Sequence GCCTGTGACACTCTATACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029012299_1029012301 12 Left 1029012299 7:97274450-97274472 CCTGGGTATAGAGTGTCACAGGC No data
Right 1029012301 7:97274485-97274507 AGAATCTGTATTTTTAGTAGAGG No data
1029012299_1029012304 20 Left 1029012299 7:97274450-97274472 CCTGGGTATAGAGTGTCACAGGC No data
Right 1029012304 7:97274493-97274515 TATTTTTAGTAGAGGGCAGTGGG No data
1029012299_1029012303 19 Left 1029012299 7:97274450-97274472 CCTGGGTATAGAGTGTCACAGGC No data
Right 1029012303 7:97274492-97274514 GTATTTTTAGTAGAGGGCAGTGG No data
1029012299_1029012302 13 Left 1029012299 7:97274450-97274472 CCTGGGTATAGAGTGTCACAGGC No data
Right 1029012302 7:97274486-97274508 GAATCTGTATTTTTAGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029012299 Original CRISPR GCCTGTGACACTCTATACCC AGG (reversed) Intergenic
No off target data available for this crispr