ID: 1029012304

View in Genome Browser
Species Human (GRCh38)
Location 7:97274493-97274515
Sequence TATTTTTAGTAGAGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029012299_1029012304 20 Left 1029012299 7:97274450-97274472 CCTGGGTATAGAGTGTCACAGGC No data
Right 1029012304 7:97274493-97274515 TATTTTTAGTAGAGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029012304 Original CRISPR TATTTTTAGTAGAGGGCAGT GGG Intergenic
No off target data available for this crispr