ID: 1029025401

View in Genome Browser
Species Human (GRCh38)
Location 7:97411964-97411986
Sequence CAATATTCCAAGAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029025397_1029025401 -2 Left 1029025397 7:97411943-97411965 CCAATGGCTTACTTAGGTAGTCA No data
Right 1029025401 7:97411964-97411986 CAATATTCCAAGAGGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029025401 Original CRISPR CAATATTCCAAGAGGGAAGT GGG Intergenic
No off target data available for this crispr