ID: 1029026979

View in Genome Browser
Species Human (GRCh38)
Location 7:97427161-97427183
Sequence TGCCTGGCTCCGTATGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029026979_1029026988 2 Left 1029026979 7:97427161-97427183 CCCCCCACATACGGAGCCAGGCA No data
Right 1029026988 7:97427186-97427208 AGAAAACGCTCCTTAGTGGGAGG No data
1029026979_1029026987 -1 Left 1029026979 7:97427161-97427183 CCCCCCACATACGGAGCCAGGCA No data
Right 1029026987 7:97427183-97427205 AGGAGAAAACGCTCCTTAGTGGG No data
1029026979_1029026986 -2 Left 1029026979 7:97427161-97427183 CCCCCCACATACGGAGCCAGGCA No data
Right 1029026986 7:97427182-97427204 CAGGAGAAAACGCTCCTTAGTGG No data
1029026979_1029026990 19 Left 1029026979 7:97427161-97427183 CCCCCCACATACGGAGCCAGGCA No data
Right 1029026990 7:97427203-97427225 GGGAGGCTTGCCAGTAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029026979 Original CRISPR TGCCTGGCTCCGTATGTGGG GGG (reversed) Intergenic
No off target data available for this crispr