ID: 1029027369

View in Genome Browser
Species Human (GRCh38)
Location 7:97431135-97431157
Sequence TTGGCTCCTGTTCCTCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029027366_1029027369 1 Left 1029027366 7:97431111-97431133 CCCAGTGAGGAAGGGTTTGGTGT No data
Right 1029027369 7:97431135-97431157 TTGGCTCCTGTTCCTCTGTCTGG No data
1029027367_1029027369 0 Left 1029027367 7:97431112-97431134 CCAGTGAGGAAGGGTTTGGTGTG No data
Right 1029027369 7:97431135-97431157 TTGGCTCCTGTTCCTCTGTCTGG No data
1029027365_1029027369 2 Left 1029027365 7:97431110-97431132 CCCCAGTGAGGAAGGGTTTGGTG No data
Right 1029027369 7:97431135-97431157 TTGGCTCCTGTTCCTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029027369 Original CRISPR TTGGCTCCTGTTCCTCTGTC TGG Intergenic
No off target data available for this crispr