ID: 1029028177

View in Genome Browser
Species Human (GRCh38)
Location 7:97440107-97440129
Sequence CCTTCACTACGGTGCCTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029028173_1029028177 0 Left 1029028173 7:97440084-97440106 CCTTGCATGGGCTTATCTCATAA No data
Right 1029028177 7:97440107-97440129 CCTTCACTACGGTGCCTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029028177 Original CRISPR CCTTCACTACGGTGCCTAGG TGG Intergenic
No off target data available for this crispr