ID: 1029028177 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:97440107-97440129 |
Sequence | CCTTCACTACGGTGCCTAGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1029028173_1029028177 | 0 | Left | 1029028173 | 7:97440084-97440106 | CCTTGCATGGGCTTATCTCATAA | No data | ||
Right | 1029028177 | 7:97440107-97440129 | CCTTCACTACGGTGCCTAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1029028177 | Original CRISPR | CCTTCACTACGGTGCCTAGG TGG | Intergenic | ||
No off target data available for this crispr |