ID: 1029042610

View in Genome Browser
Species Human (GRCh38)
Location 7:97593395-97593417
Sequence AGGGAGAGTGCAGTGGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029042610_1029042619 25 Left 1029042610 7:97593395-97593417 CCCACAGCCACTGCACTCTCCCT No data
Right 1029042619 7:97593443-97593465 CATGCAGCTGCCAAAGGACAGGG No data
1029042610_1029042618 24 Left 1029042610 7:97593395-97593417 CCCACAGCCACTGCACTCTCCCT No data
Right 1029042618 7:97593442-97593464 CCATGCAGCTGCCAAAGGACAGG No data
1029042610_1029042620 28 Left 1029042610 7:97593395-97593417 CCCACAGCCACTGCACTCTCCCT No data
Right 1029042620 7:97593446-97593468 GCAGCTGCCAAAGGACAGGGAGG No data
1029042610_1029042616 19 Left 1029042610 7:97593395-97593417 CCCACAGCCACTGCACTCTCCCT No data
Right 1029042616 7:97593437-97593459 TTTCTCCATGCAGCTGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029042610 Original CRISPR AGGGAGAGTGCAGTGGCTGT GGG (reversed) Intergenic
No off target data available for this crispr