ID: 1029044557

View in Genome Browser
Species Human (GRCh38)
Location 7:97614016-97614038
Sequence CAGCGCGATTCCGTGGGCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2942
Summary {0: 16, 1: 450, 2: 786, 3: 859, 4: 831}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029044557_1029044563 28 Left 1029044557 7:97614016-97614038 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1029044563 7:97614067-97614089 CTGCAAGGCGGCAACGAGGCTGG 0: 315
1: 1152
2: 1845
3: 1595
4: 741
1029044557_1029044564 29 Left 1029044557 7:97614016-97614038 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1029044564 7:97614068-97614090 TGCAAGGCGGCAACGAGGCTGGG 0: 317
1: 1173
2: 1908
3: 1654
4: 702
1029044557_1029044560 13 Left 1029044557 7:97614016-97614038 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1029044560 7:97614052-97614074 CAGTCTGAGATCAAACTGCAAGG 0: 3663
1: 1439
2: 732
3: 491
4: 588
1029044557_1029044565 30 Left 1029044557 7:97614016-97614038 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1029044565 7:97614069-97614091 GCAAGGCGGCAACGAGGCTGGGG 0: 316
1: 1145
2: 1873
3: 1683
4: 815
1029044557_1029044561 16 Left 1029044557 7:97614016-97614038 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1029044561 7:97614055-97614077 TCTGAGATCAAACTGCAAGGCGG 0: 2869
1: 1007
2: 456
3: 293
4: 360
1029044557_1029044562 24 Left 1029044557 7:97614016-97614038 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1029044562 7:97614063-97614085 CAAACTGCAAGGCGGCAACGAGG 0: 317
1: 1166
2: 1768
3: 1553
4: 836

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029044557 Original CRISPR CAGCGCGATTCCGTGGGCGT AGG (reversed) Intergenic
Too many off-targets to display for this crispr