ID: 1029045262

View in Genome Browser
Species Human (GRCh38)
Location 7:97621294-97621316
Sequence CTGGGGTGAGGGTCTGCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029045262_1029045271 27 Left 1029045262 7:97621294-97621316 CCTTAAGCAGACCCTCACCCCAG No data
Right 1029045271 7:97621344-97621366 ATGTGCTATCAGAAGAGTAAGGG No data
1029045262_1029045269 4 Left 1029045262 7:97621294-97621316 CCTTAAGCAGACCCTCACCCCAG No data
Right 1029045269 7:97621321-97621343 TAGATACAAATGATTTATTAAGG No data
1029045262_1029045272 28 Left 1029045262 7:97621294-97621316 CCTTAAGCAGACCCTCACCCCAG No data
Right 1029045272 7:97621345-97621367 TGTGCTATCAGAAGAGTAAGGGG No data
1029045262_1029045270 26 Left 1029045262 7:97621294-97621316 CCTTAAGCAGACCCTCACCCCAG No data
Right 1029045270 7:97621343-97621365 GATGTGCTATCAGAAGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029045262 Original CRISPR CTGGGGTGAGGGTCTGCTTA AGG (reversed) Intergenic
No off target data available for this crispr