ID: 1029045265

View in Genome Browser
Species Human (GRCh38)
Location 7:97621306-97621328
Sequence TGTATCTAAATCCTGGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029045265_1029045271 15 Left 1029045265 7:97621306-97621328 CCTCACCCCAGGATTTAGATACA No data
Right 1029045271 7:97621344-97621366 ATGTGCTATCAGAAGAGTAAGGG No data
1029045265_1029045270 14 Left 1029045265 7:97621306-97621328 CCTCACCCCAGGATTTAGATACA No data
Right 1029045270 7:97621343-97621365 GATGTGCTATCAGAAGAGTAAGG No data
1029045265_1029045273 29 Left 1029045265 7:97621306-97621328 CCTCACCCCAGGATTTAGATACA No data
Right 1029045273 7:97621358-97621380 GAGTAAGGGGTAGAAGAAACAGG No data
1029045265_1029045272 16 Left 1029045265 7:97621306-97621328 CCTCACCCCAGGATTTAGATACA No data
Right 1029045272 7:97621345-97621367 TGTGCTATCAGAAGAGTAAGGGG No data
1029045265_1029045269 -8 Left 1029045265 7:97621306-97621328 CCTCACCCCAGGATTTAGATACA No data
Right 1029045269 7:97621321-97621343 TAGATACAAATGATTTATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029045265 Original CRISPR TGTATCTAAATCCTGGGGTG AGG (reversed) Intergenic
No off target data available for this crispr