ID: 1029045268

View in Genome Browser
Species Human (GRCh38)
Location 7:97621313-97621335
Sequence AATCATTTGTATCTAAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029045268_1029045270 7 Left 1029045268 7:97621313-97621335 CCAGGATTTAGATACAAATGATT No data
Right 1029045270 7:97621343-97621365 GATGTGCTATCAGAAGAGTAAGG No data
1029045268_1029045273 22 Left 1029045268 7:97621313-97621335 CCAGGATTTAGATACAAATGATT No data
Right 1029045273 7:97621358-97621380 GAGTAAGGGGTAGAAGAAACAGG No data
1029045268_1029045275 28 Left 1029045268 7:97621313-97621335 CCAGGATTTAGATACAAATGATT No data
Right 1029045275 7:97621364-97621386 GGGGTAGAAGAAACAGGATTGGG No data
1029045268_1029045271 8 Left 1029045268 7:97621313-97621335 CCAGGATTTAGATACAAATGATT No data
Right 1029045271 7:97621344-97621366 ATGTGCTATCAGAAGAGTAAGGG No data
1029045268_1029045274 27 Left 1029045268 7:97621313-97621335 CCAGGATTTAGATACAAATGATT No data
Right 1029045274 7:97621363-97621385 AGGGGTAGAAGAAACAGGATTGG No data
1029045268_1029045272 9 Left 1029045268 7:97621313-97621335 CCAGGATTTAGATACAAATGATT No data
Right 1029045272 7:97621345-97621367 TGTGCTATCAGAAGAGTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029045268 Original CRISPR AATCATTTGTATCTAAATCC TGG (reversed) Intergenic
No off target data available for this crispr