ID: 1029045271

View in Genome Browser
Species Human (GRCh38)
Location 7:97621344-97621366
Sequence ATGTGCTATCAGAAGAGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029045268_1029045271 8 Left 1029045268 7:97621313-97621335 CCAGGATTTAGATACAAATGATT No data
Right 1029045271 7:97621344-97621366 ATGTGCTATCAGAAGAGTAAGGG No data
1029045266_1029045271 10 Left 1029045266 7:97621311-97621333 CCCCAGGATTTAGATACAAATGA No data
Right 1029045271 7:97621344-97621366 ATGTGCTATCAGAAGAGTAAGGG No data
1029045261_1029045271 28 Left 1029045261 7:97621293-97621315 CCCTTAAGCAGACCCTCACCCCA No data
Right 1029045271 7:97621344-97621366 ATGTGCTATCAGAAGAGTAAGGG No data
1029045262_1029045271 27 Left 1029045262 7:97621294-97621316 CCTTAAGCAGACCCTCACCCCAG No data
Right 1029045271 7:97621344-97621366 ATGTGCTATCAGAAGAGTAAGGG No data
1029045265_1029045271 15 Left 1029045265 7:97621306-97621328 CCTCACCCCAGGATTTAGATACA No data
Right 1029045271 7:97621344-97621366 ATGTGCTATCAGAAGAGTAAGGG No data
1029045267_1029045271 9 Left 1029045267 7:97621312-97621334 CCCAGGATTTAGATACAAATGAT No data
Right 1029045271 7:97621344-97621366 ATGTGCTATCAGAAGAGTAAGGG No data
1029045264_1029045271 16 Left 1029045264 7:97621305-97621327 CCCTCACCCCAGGATTTAGATAC No data
Right 1029045271 7:97621344-97621366 ATGTGCTATCAGAAGAGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029045271 Original CRISPR ATGTGCTATCAGAAGAGTAA GGG Intergenic
No off target data available for this crispr