ID: 1029046865

View in Genome Browser
Species Human (GRCh38)
Location 7:97639253-97639275
Sequence CCAGCTGAGACTGCAGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029046860_1029046865 -2 Left 1029046860 7:97639232-97639254 CCTCAGCCTCCTTTGAATCTTCC No data
Right 1029046865 7:97639253-97639275 CCAGCTGAGACTGCAGGCTCTGG No data
1029046857_1029046865 16 Left 1029046857 7:97639214-97639236 CCCCAGCTGATGAGTCATCCTCA No data
Right 1029046865 7:97639253-97639275 CCAGCTGAGACTGCAGGCTCTGG No data
1029046856_1029046865 21 Left 1029046856 7:97639209-97639231 CCTAGCCCCAGCTGATGAGTCAT No data
Right 1029046865 7:97639253-97639275 CCAGCTGAGACTGCAGGCTCTGG No data
1029046861_1029046865 -8 Left 1029046861 7:97639238-97639260 CCTCCTTTGAATCTTCCAGCTGA No data
Right 1029046865 7:97639253-97639275 CCAGCTGAGACTGCAGGCTCTGG No data
1029046859_1029046865 14 Left 1029046859 7:97639216-97639238 CCAGCTGATGAGTCATCCTCAGC No data
Right 1029046865 7:97639253-97639275 CCAGCTGAGACTGCAGGCTCTGG No data
1029046858_1029046865 15 Left 1029046858 7:97639215-97639237 CCCAGCTGATGAGTCATCCTCAG No data
Right 1029046865 7:97639253-97639275 CCAGCTGAGACTGCAGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029046865 Original CRISPR CCAGCTGAGACTGCAGGCTC TGG Intergenic
No off target data available for this crispr