ID: 1029054925

View in Genome Browser
Species Human (GRCh38)
Location 7:97732203-97732225
Sequence AGCCGCGGCCAGCACCGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 136}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029054925_1029054936 13 Left 1029054925 7:97732203-97732225 CCCGCGCGGTGCTGGCCGCGGCT 0: 1
1: 0
2: 2
3: 12
4: 136
Right 1029054936 7:97732239-97732261 CGCCCCGCATCTGTCCGAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 42
1029054925_1029054943 25 Left 1029054925 7:97732203-97732225 CCCGCGCGGTGCTGGCCGCGGCT 0: 1
1: 0
2: 2
3: 12
4: 136
Right 1029054943 7:97732251-97732273 GTCCGAGGTGGCCGCGCTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 198
1029054925_1029054942 24 Left 1029054925 7:97732203-97732225 CCCGCGCGGTGCTGGCCGCGGCT 0: 1
1: 0
2: 2
3: 12
4: 136
Right 1029054942 7:97732250-97732272 TGTCCGAGGTGGCCGCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 76
1029054925_1029054941 23 Left 1029054925 7:97732203-97732225 CCCGCGCGGTGCTGGCCGCGGCT 0: 1
1: 0
2: 2
3: 12
4: 136
Right 1029054941 7:97732249-97732271 CTGTCCGAGGTGGCCGCGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 52
1029054925_1029054933 10 Left 1029054925 7:97732203-97732225 CCCGCGCGGTGCTGGCCGCGGCT 0: 1
1: 0
2: 2
3: 12
4: 136
Right 1029054933 7:97732236-97732258 CCCCGCCCCGCATCTGTCCGAGG 0: 1
1: 0
2: 0
3: 7
4: 162
1029054925_1029054940 22 Left 1029054925 7:97732203-97732225 CCCGCGCGGTGCTGGCCGCGGCT 0: 1
1: 0
2: 2
3: 12
4: 136
Right 1029054940 7:97732248-97732270 TCTGTCCGAGGTGGCCGCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029054925 Original CRISPR AGCCGCGGCCAGCACCGCGC GGG (reversed) Intronic
900326954 1:2113056-2113078 AGCCTCGGCCAGCAGTGGGCAGG - Intronic
902169595 1:14599150-14599172 AGCCGCGGCCAGCGCCTCGGCGG + Exonic
902455978 1:16534427-16534449 GGCGGCGGGCAGAACCGCGCGGG - Intergenic
903628065 1:24745422-24745444 AGCCGTGGCCAGCTCGACGCCGG + Exonic
903950683 1:26994328-26994350 CGCCGAGGCCAGCAGCGCGGGGG - Exonic
905221432 1:36450588-36450610 AGCCGCGCCCAACGCCGCGCCGG - Intergenic
905890543 1:41516112-41516134 GGCCCCGGCCAGCCCCGAGCTGG - Intronic
906285873 1:44587535-44587557 AGCCGAGGCCAGCACAGAGGGGG - Intronic
907906116 1:58784581-58784603 ACCGGCGGCCGCCACCGCGCGGG + Intergenic
913075445 1:115337772-115337794 AGTGGCGGCCAGCACCGCGGGGG - Intronic
914962702 1:152220373-152220395 GGCCGCGGCCAACACAGCTCTGG - Exonic
915253657 1:154608796-154608818 AGACGCGGCCACCACCGCGCTGG - Intronic
916660817 1:166921108-166921130 AGCCGCGGTCAGCATCGGTCAGG + Exonic
916725400 1:167518234-167518256 AGCAGATGCCAGCACCGGGCCGG + Intronic
922505231 1:226122153-226122175 AGCCGCGGCCACGCCAGCGCCGG - Intergenic
923810563 1:237310031-237310053 AGCCTCGGCCAGCACAGAGAAGG + Intronic
1063418021 10:5889574-5889596 AGCCCCGGCCTGCCCCGCGTGGG + Exonic
1064443104 10:15371055-15371077 AGCCGCCGCCGGCCCCGCGGCGG - Exonic
1070329166 10:75405611-75405633 AGCAGCGGCGAGGGCCGCGCGGG - Intergenic
1071503762 10:86221022-86221044 AGCCATGGCCAGCACCTCCCTGG + Intronic
1075645440 10:124093259-124093281 CGCCACCGCCACCACCGCGCCGG + Intronic
1075788016 10:125063088-125063110 AGCCTCGGCCAGCCTCGAGCTGG + Intronic
1075871342 10:125774207-125774229 GGCCGCGTCCAGCTCCCCGCTGG + Exonic
1076880351 10:133236695-133236717 AGCCGCGGTCAGGACCTGGCCGG + Intergenic
1076921323 10:133456080-133456102 AGCCGCGCCCATCACCTCTCTGG + Intergenic
1077053150 11:576697-576719 GCCCGCGGCCAGCGCGGCGCAGG - Intronic
1081854978 11:46297199-46297221 AGCCACAGCCAGGGCCGCGCTGG - Intronic
1084041725 11:66546535-66546557 AGCCTCTTCCAGCACCTCGCTGG - Exonic
1084526631 11:69702377-69702399 AGGCGCGGCCACCCCCGCCCTGG + Intronic
1090667815 11:128926583-128926605 AGCCGTGCCCAGCACCCTGCCGG + Intergenic
1094485432 12:30922973-30922995 AGAAGCTGCCAGCACCCCGCCGG + Intergenic
1096489713 12:52006956-52006978 AGCCGCCGCCAGCCCCGCCGAGG + Exonic
1100679832 12:96907255-96907277 GGCCGCGGCCGGCTCCGCGCTGG - Intronic
1103325509 12:120117266-120117288 GGCCGGGGCCAGCTCCGCGGGGG - Intronic
1103415024 12:120737856-120737878 AGCTGCGTCCACCACCGCCCGGG + Exonic
1103779525 12:123389451-123389473 CGCCGCCGCCTCCACCGCGCGGG - Exonic
1104774091 12:131382157-131382179 AGCCTCTGCCAGCACCGAGGAGG + Intergenic
1105217511 13:18297711-18297733 CGCCGCCGCCTCCACCGCGCAGG - Intergenic
1108576765 13:51797678-51797700 AGCCTCGGCCAGCAGGGAGCTGG - Intronic
1111396073 13:87671837-87671859 CGCAGCGGCGACCACCGCGCTGG - Intergenic
1113788104 13:113013455-113013477 GGCCGCAGCCAGCACGGCCCAGG + Intronic
1120836246 14:89040740-89040762 AGCCCCGGCCAGCAGCAGGCCGG - Intergenic
1121616952 14:95319809-95319831 AGCCCGGGCCAGCGCGGCGCGGG + Exonic
1122625618 14:103084123-103084145 ACCGGCGGCCAGCCCCGCGGTGG + Intergenic
1122672859 14:103385455-103385477 AGCGGCGGCCAGCAGGGCGGAGG + Intronic
1122779152 14:104136357-104136379 CGCCGCGCCCCGCACCGCGCAGG - Intergenic
1122917432 14:104865524-104865546 GGCCGCGGCCAGCGCTGGGCCGG - Intronic
1125589190 15:40844111-40844133 AGCCGCGACCCGAGCCGCGCAGG + Exonic
1125600696 15:40914431-40914453 AGCAGAGGCCATCACCGGGCAGG - Intergenic
1126112639 15:45184828-45184850 AGCCGCGCCCTGCAACGGGCAGG - Intronic
1127331808 15:57947269-57947291 AGCTGTGGCCAACACCCCGCAGG + Intergenic
1128156713 15:65396057-65396079 AGCCGCGGCCAGCGCTGCGCTGG - Exonic
1129717453 15:77860446-77860468 AGCCTCCGCCAGCACAGAGCGGG + Intergenic
1132055650 15:98648875-98648897 CGCCGCCGCCCGCCCCGCGCCGG - Intergenic
1132453619 16:10514-10536 AGACGCGGAGAGCACCGCGAGGG - Intergenic
1132729219 16:1352328-1352350 CCCCGCGGCCACCCCCGCGCCGG - Intronic
1132837029 16:1959366-1959388 ACCAGCGACCAGCACCGCGTAGG + Intergenic
1135158475 16:20073677-20073699 CGCCGCCGCCACCACCGAGCCGG - Exonic
1141617894 16:85220616-85220638 AGCAGCGGGCAGCAGCGGGCAGG - Intergenic
1143112186 17:4558951-4558973 AGCCGCGGGCAGCCCCAGGCCGG + Exonic
1143596178 17:7915693-7915715 GGACGCCGCCAGCGCCGCGCAGG + Intergenic
1144786735 17:17836397-17836419 AGCCGTGGCCATCACAGGGCTGG + Intronic
1147044464 17:37743070-37743092 AGCTGCGGCCAGCCCGGCGCGGG + Intronic
1149998435 17:61417013-61417035 AGCCACTGCCCGCACAGCGCAGG - Intergenic
1151612047 17:75182688-75182710 AGCCGCGGCCGGCCCCGTGGGGG + Intergenic
1152433101 17:80260503-80260525 CGCCGCCGCCGGCCCCGCGCAGG - Intergenic
1157332907 18:46716474-46716496 AGCCTGGGCCAGCCCCGCTCCGG + Intronic
1160436751 18:78857732-78857754 AGATGCGGCCGGCTCCGCGCCGG + Intergenic
1160578381 18:79869873-79869895 AGCCGCCGCCACCACCACGCGGG + Intronic
1160801820 19:973915-973937 AGCCCCGCCCAACACCACGCGGG - Exonic
1162932504 19:13963996-13964018 AGCCGCGGCCACCTGCGTGCAGG + Exonic
1166934343 19:46321915-46321937 AGCCACTCCCAGCACCCCGCTGG + Exonic
1167709943 19:51104399-51104421 GCCCACGGCCACCACCGCGCCGG + Exonic
1167843378 19:52139996-52140018 AGCCGCGACCAGCAAGGGGCGGG + Intergenic
1168323123 19:55521972-55521994 AGCCAGGGCCAGCACTGGGCGGG - Intergenic
1168489354 19:56795337-56795359 AGCCGCGCGCTGCCCCGCGCTGG + Intronic
926147042 2:10402818-10402840 AGCCGTGGGCAGCACAGCACAGG + Intronic
929909028 2:46073174-46073196 AGCCGAGGCCAGCATCCCCCAGG + Intronic
932773245 2:74513347-74513369 TACCGCGGCCTGCACCGGGCAGG + Intergenic
934882502 2:97995961-97995983 AGCCGCGCCCCGCCCCTCGCAGG - Intergenic
936412737 2:112275294-112275316 AACCGCGGCCCGTACTGCGCCGG + Intergenic
936713794 2:115162041-115162063 AGCCGCGGCCAGGCCCTCCCGGG + Intronic
937221609 2:120345688-120345710 AGCCGCGCCCGGCTCCGCTCCGG + Intergenic
942044940 2:172094840-172094862 AGCCGAGGCCAGACCCGCGGAGG + Intergenic
942453798 2:176124177-176124199 CGCTCCCGCCAGCACCGCGCCGG - Exonic
947792450 2:232876079-232876101 ACCCGAGGACAGCACCGCGCAGG + Exonic
948237586 2:236402112-236402134 AGCCGCTGCCAGCCCTGAGCTGG - Intronic
1168978322 20:1984529-1984551 AACCCCGGCCAGCACATCGCAGG + Intronic
1169213038 20:3778190-3778212 AGCGGCGGCCCGGGCCGCGCGGG - Exonic
1170889004 20:20363895-20363917 AGCGGCCGCCAGCACCTCACAGG + Intergenic
1172600599 20:36180073-36180095 AGCCCCTGCCAGCACAGCCCAGG + Intronic
1174467967 20:50731801-50731823 AGCCGCTGCCCGCCCCGTGCCGG - Exonic
1175199168 20:57266299-57266321 GCCCGGGGCCAGCACCGAGCAGG - Exonic
1176002747 20:62840319-62840341 AGGCGCGGCCAGCCCCAGGCAGG - Intronic
1179213659 21:39348845-39348867 AGCCGCCGCCGGCGCCCCGCCGG - Intronic
1180109840 21:45642777-45642799 AGACGCTGCCCGCCCCGCGCTGG - Intergenic
1184684487 22:46089981-46090003 AGCCCTGGCCAGGACCGCGGCGG - Intronic
1184735391 22:46394894-46394916 AGCAGCGGCCAGCACCTCGGAGG - Intronic
1185259508 22:49853807-49853829 AGCCCCGCCCCGCGCCGCGCGGG + Intergenic
1185316188 22:50180181-50180203 AGCCCCGGCCGGCACCCGGCTGG + Exonic
1185397405 22:50600246-50600268 AGCCCCGGTCAGCACCCCGTGGG + Intronic
954077005 3:48188661-48188683 AGCCGCGAGCAGCGCCTCGCAGG - Intergenic
956179069 3:66500865-66500887 CGGCGCGGCCGGCCCCGCGCTGG + Exonic
956659493 3:71583828-71583850 AGGCGCGGGCAGCACCGGCCCGG + Intronic
958814517 3:98901373-98901395 TGCCGCGGCCAGAGGCGCGCGGG - Exonic
962325701 3:134430331-134430353 AGCTGCGTCCAGCACCCTGCTGG + Intergenic
967852893 3:194095533-194095555 AGCCAGGGCAAGCACCGAGCAGG - Intergenic
968674512 4:1870677-1870699 AGCCGCGCCCAGCTCCGGGTCGG + Intergenic
968704152 4:2070227-2070249 AGGCAGGGGCAGCACCGCGCTGG + Intergenic
968845984 4:3041794-3041816 AGCCGCAGCCAGCGCCGGGCCGG - Intergenic
984811164 4:183797571-183797593 AGGCGCGGCCAGCCCTGCCCTGG + Intergenic
985681212 5:1256881-1256903 AGGCGCGGCCAGCACGGGCCAGG + Intronic
986104141 5:4643747-4643769 GGCCACAGCAAGCACCGCGCTGG - Intergenic
989475715 5:41870500-41870522 AGCAGCAGCCAGCAGCGCGCCGG - Exonic
992067218 5:73119837-73119859 AGACGCGGCAAGCCCCGCGCCGG - Intergenic
992098437 5:73382569-73382591 AGCCGAGGGCGGAACCGCGCGGG - Intergenic
997013076 5:129903009-129903031 GGACGCTGCCAGCACCTCGCTGG + Intergenic
999230614 5:150059748-150059770 AGCCCCGGCCAGGACCCCGAGGG - Exonic
1003116484 6:3286973-3286995 TACCACGGCCAGCATCGCGCTGG - Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006337434 6:33427990-33428012 CGCCGCCGCCCCCACCGCGCCGG + Intronic
1006603916 6:35243203-35243225 AGGCCCGGGCAGCACCGTGCTGG + Exonic
1010270322 6:73909930-73909952 AGCCTCGGCCAGCACAGAGACGG - Intergenic
1017324772 6:153131630-153131652 AGCCCAGGACAGCAGCGCGCGGG - Intergenic
1019473116 7:1231643-1231665 AGCCTCGGCCAGCCCAGGGCGGG - Intergenic
1028268722 7:88759851-88759873 AGACGCGGCCAGCAGGACGCAGG - Exonic
1029054925 7:97732203-97732225 AGCCGCGGCCAGCACCGCGCGGG - Intronic
1030121110 7:106111964-106111986 GGCCGCGGCCTGGGCCGCGCGGG - Intronic
1032013623 7:128361823-128361845 AGCCGCGGCCACCTCGGTGCCGG + Intergenic
1033490586 7:141839352-141839374 AGCTGGGGCCAGCACCCAGCTGG + Exonic
1034400861 7:150860653-150860675 AGGCAGGGCCAGCACCGGGCAGG - Intronic
1034491617 7:151396016-151396038 GGCCGCGGCCTCCTCCGCGCAGG + Exonic
1035378938 7:158425881-158425903 AGCTGAGGCCTGCACAGCGCCGG + Intronic
1035379403 7:158427978-158428000 AGCTGAGGCCTGCACAGCGCCGG + Intronic
1035745209 8:1957128-1957150 AGCCAAGGCCAGCTCGGCGCTGG + Exonic
1036482488 8:9151093-9151115 AGCCGGGCCCAGCAGCGCGGTGG + Intronic
1037473872 8:19237559-19237581 AGCCGCGGCCAGCGCCCGGGCGG - Intergenic
1037517341 8:19645833-19645855 AGCCCAGGCCAGCACTGCCCTGG - Intronic
1042021446 8:64374012-64374034 AGCCCCGGCCAGCCGCGGGCCGG + Intergenic
1048292424 8:133191186-133191208 AGCAGCCGCCAGCACCGTCCTGG + Exonic
1049309155 8:141924247-141924269 AGCTGAGGCCAGCACCTCTCAGG - Intergenic
1054765017 9:69035969-69035991 AGCCGCGGGCCGCACGCCGCGGG + Intronic
1056192179 9:84195028-84195050 AGCAGCGGCCATCACCACACTGG - Intergenic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057596300 9:96418361-96418383 AGCCGGGGCAGGCACCGCGGCGG - Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1058379620 9:104363319-104363341 AGCCTCGGCCAGCACAGAGAGGG + Intergenic
1060583417 9:124771220-124771242 AGCCGCGGCCGGGAGCTCGCGGG - Exonic
1061765348 9:132878131-132878153 AGCCGCCGCCAGCGTCGCGACGG + Intronic
1191797277 X:65034787-65034809 CGCCGCGGCGATAACCGCGCCGG + Intergenic