ID: 1029059734

View in Genome Browser
Species Human (GRCh38)
Location 7:97785099-97785121
Sequence GTTTCAGTGATCCTTGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029059734_1029059738 -3 Left 1029059734 7:97785099-97785121 CCAGCTTCAAGGATCACTGAAAC No data
Right 1029059738 7:97785119-97785141 AACACTAAGGGGATGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029059734 Original CRISPR GTTTCAGTGATCCTTGAAGC TGG (reversed) Intergenic