ID: 1029061048

View in Genome Browser
Species Human (GRCh38)
Location 7:97798217-97798239
Sequence TGGCGGTCCAACTCCAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029061048_1029061058 23 Left 1029061048 7:97798217-97798239 CCAACCCTGGAGTTGGACCGCCA No data
Right 1029061058 7:97798263-97798285 CCTATTAGCTGTTTAACACTGGG No data
1029061048_1029061056 22 Left 1029061048 7:97798217-97798239 CCAACCCTGGAGTTGGACCGCCA No data
Right 1029061056 7:97798262-97798284 ACCTATTAGCTGTTTAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029061048 Original CRISPR TGGCGGTCCAACTCCAGGGT TGG (reversed) Intergenic
No off target data available for this crispr