ID: 1029061053

View in Genome Browser
Species Human (GRCh38)
Location 7:97798234-97798256
Sequence ACTTGGACATTGAACCCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029061053_1029061059 25 Left 1029061053 7:97798234-97798256 CCGCCAGGGTTCAATGTCCAAGT No data
Right 1029061059 7:97798282-97798304 TGGGAAACTTCCTTGTTTTGTGG No data
1029061053_1029061058 6 Left 1029061053 7:97798234-97798256 CCGCCAGGGTTCAATGTCCAAGT No data
Right 1029061058 7:97798263-97798285 CCTATTAGCTGTTTAACACTGGG No data
1029061053_1029061056 5 Left 1029061053 7:97798234-97798256 CCGCCAGGGTTCAATGTCCAAGT No data
Right 1029061056 7:97798262-97798284 ACCTATTAGCTGTTTAACACTGG No data
1029061053_1029061060 26 Left 1029061053 7:97798234-97798256 CCGCCAGGGTTCAATGTCCAAGT No data
Right 1029061060 7:97798283-97798305 GGGAAACTTCCTTGTTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029061053 Original CRISPR ACTTGGACATTGAACCCTGG CGG (reversed) Intergenic
No off target data available for this crispr