ID: 1029061054

View in Genome Browser
Species Human (GRCh38)
Location 7:97798237-97798259
Sequence CAGACTTGGACATTGAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029061054_1029061059 22 Left 1029061054 7:97798237-97798259 CCAGGGTTCAATGTCCAAGTCTG No data
Right 1029061059 7:97798282-97798304 TGGGAAACTTCCTTGTTTTGTGG No data
1029061054_1029061060 23 Left 1029061054 7:97798237-97798259 CCAGGGTTCAATGTCCAAGTCTG No data
Right 1029061060 7:97798283-97798305 GGGAAACTTCCTTGTTTTGTGGG No data
1029061054_1029061056 2 Left 1029061054 7:97798237-97798259 CCAGGGTTCAATGTCCAAGTCTG No data
Right 1029061056 7:97798262-97798284 ACCTATTAGCTGTTTAACACTGG No data
1029061054_1029061058 3 Left 1029061054 7:97798237-97798259 CCAGGGTTCAATGTCCAAGTCTG No data
Right 1029061058 7:97798263-97798285 CCTATTAGCTGTTTAACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029061054 Original CRISPR CAGACTTGGACATTGAACCC TGG (reversed) Intergenic
No off target data available for this crispr