ID: 1029061056

View in Genome Browser
Species Human (GRCh38)
Location 7:97798262-97798284
Sequence ACCTATTAGCTGTTTAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029061046_1029061056 24 Left 1029061046 7:97798215-97798237 CCCCAACCCTGGAGTTGGACCGC No data
Right 1029061056 7:97798262-97798284 ACCTATTAGCTGTTTAACACTGG No data
1029061053_1029061056 5 Left 1029061053 7:97798234-97798256 CCGCCAGGGTTCAATGTCCAAGT No data
Right 1029061056 7:97798262-97798284 ACCTATTAGCTGTTTAACACTGG No data
1029061052_1029061056 17 Left 1029061052 7:97798222-97798244 CCTGGAGTTGGACCGCCAGGGTT No data
Right 1029061056 7:97798262-97798284 ACCTATTAGCTGTTTAACACTGG No data
1029061051_1029061056 18 Left 1029061051 7:97798221-97798243 CCCTGGAGTTGGACCGCCAGGGT No data
Right 1029061056 7:97798262-97798284 ACCTATTAGCTGTTTAACACTGG No data
1029061047_1029061056 23 Left 1029061047 7:97798216-97798238 CCCAACCCTGGAGTTGGACCGCC No data
Right 1029061056 7:97798262-97798284 ACCTATTAGCTGTTTAACACTGG No data
1029061048_1029061056 22 Left 1029061048 7:97798217-97798239 CCAACCCTGGAGTTGGACCGCCA No data
Right 1029061056 7:97798262-97798284 ACCTATTAGCTGTTTAACACTGG No data
1029061054_1029061056 2 Left 1029061054 7:97798237-97798259 CCAGGGTTCAATGTCCAAGTCTG No data
Right 1029061056 7:97798262-97798284 ACCTATTAGCTGTTTAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029061056 Original CRISPR ACCTATTAGCTGTTTAACAC TGG Intergenic
No off target data available for this crispr