ID: 1029061059

View in Genome Browser
Species Human (GRCh38)
Location 7:97798282-97798304
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029061057_1029061059 -4 Left 1029061057 7:97798263-97798285 CCTATTAGCTGTTTAACACTGGG No data
Right 1029061059 7:97798282-97798304 TGGGAAACTTCCTTGTTTTGTGG No data
1029061054_1029061059 22 Left 1029061054 7:97798237-97798259 CCAGGGTTCAATGTCCAAGTCTG No data
Right 1029061059 7:97798282-97798304 TGGGAAACTTCCTTGTTTTGTGG No data
1029061055_1029061059 8 Left 1029061055 7:97798251-97798273 CCAAGTCTGTTACCTATTAGCTG No data
Right 1029061059 7:97798282-97798304 TGGGAAACTTCCTTGTTTTGTGG No data
1029061053_1029061059 25 Left 1029061053 7:97798234-97798256 CCGCCAGGGTTCAATGTCCAAGT No data
Right 1029061059 7:97798282-97798304 TGGGAAACTTCCTTGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029061059 Original CRISPR TGGGAAACTTCCTTGTTTTG TGG Intergenic
No off target data available for this crispr