ID: 1029074595

View in Genome Browser
Species Human (GRCh38)
Location 7:97925892-97925914
Sequence GCTGTTGGTCAGACACACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029074592_1029074595 -10 Left 1029074592 7:97925879-97925901 CCCTCCAGGAAGAGCTGTTGGTC No data
Right 1029074595 7:97925892-97925914 GCTGTTGGTCAGACACACCCTGG No data
1029074589_1029074595 8 Left 1029074589 7:97925861-97925883 CCTAGGAGAGACTTGTCTCCCTC No data
Right 1029074595 7:97925892-97925914 GCTGTTGGTCAGACACACCCTGG No data
1029074588_1029074595 15 Left 1029074588 7:97925854-97925876 CCAAATACCTAGGAGAGACTTGT No data
Right 1029074595 7:97925892-97925914 GCTGTTGGTCAGACACACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029074595 Original CRISPR GCTGTTGGTCAGACACACCC TGG Intergenic
No off target data available for this crispr