ID: 1029075141

View in Genome Browser
Species Human (GRCh38)
Location 7:97928711-97928733
Sequence CTGTGTCTTGCATGATTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029075135_1029075141 5 Left 1029075135 7:97928683-97928705 CCACAGCCACCTTGTCTTTGCTC No data
Right 1029075141 7:97928711-97928733 CTGTGTCTTGCATGATTTGGAGG No data
1029075133_1029075141 25 Left 1029075133 7:97928663-97928685 CCCGAGAGGGTGGACATCGGCCA No data
Right 1029075141 7:97928711-97928733 CTGTGTCTTGCATGATTTGGAGG No data
1029075134_1029075141 24 Left 1029075134 7:97928664-97928686 CCGAGAGGGTGGACATCGGCCAC No data
Right 1029075141 7:97928711-97928733 CTGTGTCTTGCATGATTTGGAGG No data
1029075132_1029075141 26 Left 1029075132 7:97928662-97928684 CCCCGAGAGGGTGGACATCGGCC No data
Right 1029075141 7:97928711-97928733 CTGTGTCTTGCATGATTTGGAGG No data
1029075136_1029075141 -1 Left 1029075136 7:97928689-97928711 CCACCTTGTCTTTGCTCTTACCC No data
Right 1029075141 7:97928711-97928733 CTGTGTCTTGCATGATTTGGAGG No data
1029075137_1029075141 -4 Left 1029075137 7:97928692-97928714 CCTTGTCTTTGCTCTTACCCTGT No data
Right 1029075141 7:97928711-97928733 CTGTGTCTTGCATGATTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029075141 Original CRISPR CTGTGTCTTGCATGATTTGG AGG Intergenic
No off target data available for this crispr