ID: 1029075926

View in Genome Browser
Species Human (GRCh38)
Location 7:97934106-97934128
Sequence CAGTCTGACTGGAGGAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029075922_1029075926 -1 Left 1029075922 7:97934084-97934106 CCACTTTGTGCTATAAAAAGAGC No data
Right 1029075926 7:97934106-97934128 CAGTCTGACTGGAGGAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029075926 Original CRISPR CAGTCTGACTGGAGGAGAGT GGG Intergenic
No off target data available for this crispr