ID: 1029078719

View in Genome Browser
Species Human (GRCh38)
Location 7:97955913-97955935
Sequence ATGCACACCCACTGCTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029078719_1029078724 9 Left 1029078719 7:97955913-97955935 CCAAGATAGCAGTGGGTGTGCAT No data
Right 1029078724 7:97955945-97955967 GATATTCCTCCTAATATTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029078719 Original CRISPR ATGCACACCCACTGCTATCT TGG (reversed) Intergenic
No off target data available for this crispr