ID: 1029085616

View in Genome Browser
Species Human (GRCh38)
Location 7:98009403-98009425
Sequence GCACCGTGCTCGGCCAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029085607_1029085616 23 Left 1029085607 7:98009357-98009379 CCCGCTTCGGCCTCTCAAAGTGC 0: 79
1: 5417
2: 104509
3: 241484
4: 236920
Right 1029085616 7:98009403-98009425 GCACCGTGCTCGGCCAGAACTGG No data
1029085608_1029085616 22 Left 1029085608 7:98009358-98009380 CCGCTTCGGCCTCTCAAAGTGCT 0: 121
1: 5930
2: 106213
3: 195519
4: 131772
Right 1029085616 7:98009403-98009425 GCACCGTGCTCGGCCAGAACTGG No data
1029085611_1029085616 13 Left 1029085611 7:98009367-98009389 CCTCTCAAAGTGCTGGGATTACA 0: 11074
1: 304386
2: 264969
3: 149159
4: 134834
Right 1029085616 7:98009403-98009425 GCACCGTGCTCGGCCAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029085616 Original CRISPR GCACCGTGCTCGGCCAGAAC TGG Intergenic
No off target data available for this crispr