ID: 1029085990

View in Genome Browser
Species Human (GRCh38)
Location 7:98012187-98012209
Sequence TGGGAGGATCGCTGAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102195
Summary {0: 9, 1: 362, 2: 5645, 3: 30290, 4: 65889}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029085990_1029085992 -5 Left 1029085990 7:98012187-98012209 CCTGGGCTTCAGCGATCCTCCCA 0: 9
1: 362
2: 5645
3: 30290
4: 65889
Right 1029085992 7:98012205-98012227 TCCCACCTCAGCCTCTCATCTGG No data
1029085990_1029086002 27 Left 1029085990 7:98012187-98012209 CCTGGGCTTCAGCGATCCTCCCA 0: 9
1: 362
2: 5645
3: 30290
4: 65889
Right 1029086002 7:98012237-98012259 CAGGTGTGCACCACCGCACCTGG 0: 41
1: 1897
2: 11282
3: 52258
4: 136533
1029085990_1029085995 -2 Left 1029085990 7:98012187-98012209 CCTGGGCTTCAGCGATCCTCCCA 0: 9
1: 362
2: 5645
3: 30290
4: 65889
Right 1029085995 7:98012208-98012230 CACCTCAGCCTCTCATCTGGTGG No data
1029085990_1029086000 8 Left 1029085990 7:98012187-98012209 CCTGGGCTTCAGCGATCCTCCCA 0: 9
1: 362
2: 5645
3: 30290
4: 65889
Right 1029086000 7:98012218-98012240 TCTCATCTGGTGGGGCCTACAGG No data
1029085990_1029085996 -1 Left 1029085990 7:98012187-98012209 CCTGGGCTTCAGCGATCCTCCCA 0: 9
1: 362
2: 5645
3: 30290
4: 65889
Right 1029085996 7:98012209-98012231 ACCTCAGCCTCTCATCTGGTGGG No data
1029085990_1029085998 0 Left 1029085990 7:98012187-98012209 CCTGGGCTTCAGCGATCCTCCCA 0: 9
1: 362
2: 5645
3: 30290
4: 65889
Right 1029085998 7:98012210-98012232 CCTCAGCCTCTCATCTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029085990 Original CRISPR TGGGAGGATCGCTGAAGCCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr