ID: 1029085998

View in Genome Browser
Species Human (GRCh38)
Location 7:98012210-98012232
Sequence CCTCAGCCTCTCATCTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029085985_1029085998 25 Left 1029085985 7:98012162-98012184 CCATAGCTCACTGCAGCCTCAAC 0: 58
1: 549
2: 1321
3: 3439
4: 6604
Right 1029085998 7:98012210-98012232 CCTCAGCCTCTCATCTGGTGGGG No data
1029085988_1029085998 9 Left 1029085988 7:98012178-98012200 CCTCAACCTCCTGGGCTTCAGCG No data
Right 1029085998 7:98012210-98012232 CCTCAGCCTCTCATCTGGTGGGG No data
1029085984_1029085998 28 Left 1029085984 7:98012159-98012181 CCACCATAGCTCACTGCAGCCTC 0: 18
1: 623
2: 1991
3: 4209
4: 12557
Right 1029085998 7:98012210-98012232 CCTCAGCCTCTCATCTGGTGGGG No data
1029085990_1029085998 0 Left 1029085990 7:98012187-98012209 CCTGGGCTTCAGCGATCCTCCCA 0: 9
1: 362
2: 5645
3: 30290
4: 65889
Right 1029085998 7:98012210-98012232 CCTCAGCCTCTCATCTGGTGGGG No data
1029085989_1029085998 3 Left 1029085989 7:98012184-98012206 CCTCCTGGGCTTCAGCGATCCTC 0: 3
1: 201
2: 3029
3: 16992
4: 57734
Right 1029085998 7:98012210-98012232 CCTCAGCCTCTCATCTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029085998 Original CRISPR CCTCAGCCTCTCATCTGGTG GGG Intergenic
No off target data available for this crispr