ID: 1029086000

View in Genome Browser
Species Human (GRCh38)
Location 7:98012218-98012240
Sequence TCTCATCTGGTGGGGCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029085991_1029086000 -8 Left 1029085991 7:98012203-98012225 CCTCCCACCTCAGCCTCTCATCT No data
Right 1029086000 7:98012218-98012240 TCTCATCTGGTGGGGCCTACAGG No data
1029085989_1029086000 11 Left 1029085989 7:98012184-98012206 CCTCCTGGGCTTCAGCGATCCTC 0: 3
1: 201
2: 3029
3: 16992
4: 57734
Right 1029086000 7:98012218-98012240 TCTCATCTGGTGGGGCCTACAGG No data
1029085990_1029086000 8 Left 1029085990 7:98012187-98012209 CCTGGGCTTCAGCGATCCTCCCA 0: 9
1: 362
2: 5645
3: 30290
4: 65889
Right 1029086000 7:98012218-98012240 TCTCATCTGGTGGGGCCTACAGG No data
1029085988_1029086000 17 Left 1029085988 7:98012178-98012200 CCTCAACCTCCTGGGCTTCAGCG No data
Right 1029086000 7:98012218-98012240 TCTCATCTGGTGGGGCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029086000 Original CRISPR TCTCATCTGGTGGGGCCTAC AGG Intergenic
No off target data available for this crispr