ID: 1029090037

View in Genome Browser
Species Human (GRCh38)
Location 7:98040801-98040823
Sequence CATCATAGGGTTACCGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029090037_1029090042 0 Left 1029090037 7:98040801-98040823 CCAGCCACGGTAACCCTATGATG No data
Right 1029090042 7:98040824-98040846 GCAACCCCCAGACTCCCTGTAGG No data
1029090037_1029090044 4 Left 1029090037 7:98040801-98040823 CCAGCCACGGTAACCCTATGATG No data
Right 1029090044 7:98040828-98040850 CCCCCAGACTCCCTGTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029090037 Original CRISPR CATCATAGGGTTACCGTGGC TGG (reversed) Intergenic
No off target data available for this crispr