ID: 1029099239

View in Genome Browser
Species Human (GRCh38)
Location 7:98114645-98114667
Sequence GAAGGGAGACGGTCGCATCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 39}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029099230_1029099239 -2 Left 1029099230 7:98114624-98114646 CCCTGTCTCCCTGCATCTGGTGA 0: 1
1: 0
2: 3
3: 33
4: 251
Right 1029099239 7:98114645-98114667 GAAGGGAGACGGTCGCATCGGGG 0: 1
1: 0
2: 0
3: 2
4: 39
1029099234_1029099239 -10 Left 1029099234 7:98114632-98114654 CCCTGCATCTGGTGAAGGGAGAC 0: 1
1: 0
2: 1
3: 9
4: 157
Right 1029099239 7:98114645-98114667 GAAGGGAGACGGTCGCATCGGGG 0: 1
1: 0
2: 0
3: 2
4: 39
1029099229_1029099239 -1 Left 1029099229 7:98114623-98114645 CCCCTGTCTCCCTGCATCTGGTG 0: 1
1: 0
2: 2
3: 42
4: 520
Right 1029099239 7:98114645-98114667 GAAGGGAGACGGTCGCATCGGGG 0: 1
1: 0
2: 0
3: 2
4: 39
1029099227_1029099239 21 Left 1029099227 7:98114601-98114623 CCTTGTGCTATGGCTAAAGTAGC 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1029099239 7:98114645-98114667 GAAGGGAGACGGTCGCATCGGGG 0: 1
1: 0
2: 0
3: 2
4: 39
1029099231_1029099239 -3 Left 1029099231 7:98114625-98114647 CCTGTCTCCCTGCATCTGGTGAA 0: 1
1: 0
2: 2
3: 23
4: 205
Right 1029099239 7:98114645-98114667 GAAGGGAGACGGTCGCATCGGGG 0: 1
1: 0
2: 0
3: 2
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029099239 Original CRISPR GAAGGGAGACGGTCGCATCG GGG Intronic
900667409 1:3824848-3824870 GAAGGGAGGCAGTGGCACCGTGG + Intronic
904604691 1:31692031-31692053 GAAGGGCGACGGAGGCATCAAGG - Exonic
906554656 1:46699297-46699319 GAAGGGTGAGGGTGGCATCGGGG + Intronic
920652789 1:207851342-207851364 GAAGGGAGAGGGTCACATGAGGG - Intergenic
922674351 1:227541873-227541895 TAAGGGAGACGGTGGGACCGAGG - Intergenic
1073292435 10:102419899-102419921 GAAGGGAGAAGCTAGCAGCGGGG - Exonic
1084169518 11:67393959-67393981 AAAGGCAGACGGTGGCATGGAGG + Intronic
1084942651 11:72621242-72621264 GAAGGGAGGAGCTCGCATCTGGG + Intronic
1085807875 11:79653058-79653080 GGAGGGAGACAGTCCCACCGCGG - Intergenic
1091002245 11:131919432-131919454 GAAGGGAGAAGGAAGCAACGGGG + Intronic
1094425922 12:30317013-30317035 GGAGGGAGAAGGTGGCATCAAGG - Intergenic
1095997988 12:48105754-48105776 GCAGGGAGACGGTCTCTCCGCGG + Exonic
1104167545 12:126248496-126248518 GAAGGGAGATGGTCAGATCAGGG + Intergenic
1114050797 14:18918857-18918879 GAAGGGAGAGGGTGGCAAGGAGG - Intergenic
1114111762 14:19483065-19483087 GAAGGGAGAGGGTGGCAAGGAGG + Intergenic
1120963617 14:90148352-90148374 GCAGGGAGAGGATCTCATCGTGG - Intronic
1129179177 15:73860840-73860862 GAAGGGAGAGGGTGGCACAGAGG + Intergenic
1132668344 16:1091882-1091904 GAAGGAAGACGGTCACTTCCAGG - Intronic
1166558827 19:43718833-43718855 ATAGGGCGACGGTTGCATCGTGG - Exonic
1168232647 19:55043013-55043035 AAAGGGAGGTGGTCGCACCGTGG + Intronic
925266915 2:2571980-2572002 GAAGGGAGACGGGGCCAGCGCGG - Intergenic
927851740 2:26503873-26503895 GCAGGGAGAGGGACGCATGGAGG + Intronic
931434759 2:62236598-62236620 TCAGGGAGACGGTCCCATAGCGG - Intergenic
1175972736 20:62695066-62695088 GACGGCAGACGGACGCATCAGGG - Intergenic
1180469274 22:15641232-15641254 GAAGGGAGAGGGTGGCAAGGAGG - Intergenic
960844440 3:121993552-121993574 GAAGGGAGTTGGACCCATCGTGG - Exonic
963053696 3:141164979-141165001 GCAGGGAGATGGTTCCATCGCGG + Intergenic
963772406 3:149401346-149401368 GAAGGGAGCAGGTGGCAGCGTGG + Intergenic
969367706 4:6708518-6708540 TAAGGGAGACTGTTACATCGGGG + Exonic
980135557 4:128855472-128855494 GAGGGGAGACGGTCGTAGCCAGG + Intronic
1001399825 5:171439774-171439796 GCAGGGAGACTCTAGCATCGGGG + Intronic
1003890585 6:10560501-10560523 AAAGGGAGGCGGTCGCTTTGAGG - Intronic
1005839092 6:29728845-29728867 GAAGGGAGAGGGTCCCTTCCAGG - Intronic
1005876551 6:30014384-30014406 GAAGGGAGAAGGTCCCTTCAGGG - Intergenic
1006423394 6:33949299-33949321 AAAGGGAGACGGTGGCCTCCTGG + Intergenic
1017746908 6:157455392-157455414 GAAGGGTGACGCTGGCATGGGGG + Intronic
1026471235 7:70695094-70695116 GAAGGGAGGCGGCCGGATCGGGG + Intronic
1029099239 7:98114645-98114667 GAAGGGAGACGGTCGCATCGGGG + Intronic
1049346330 8:142141065-142141087 GGAGGGAGAAGGTCGCTTCAGGG - Intergenic
1059102451 9:111483701-111483723 GAAGGGCGACGCTCGCGACGCGG - Intronic
1062690968 9:137841843-137841865 GGAGGGGGACGGTGGCATGGAGG - Intronic
1200981065 Y:9263678-9263700 GAAGGGAGGCAGTCACATCAAGG - Intergenic