ID: 1029099517

View in Genome Browser
Species Human (GRCh38)
Location 7:98117091-98117113
Sequence GGAGGACAGAGTAACTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029099517_1029099523 2 Left 1029099517 7:98117091-98117113 CCTGTAAAGTTACTCTGTCCTCC 0: 1
1: 0
2: 3
3: 8
4: 138
Right 1029099523 7:98117116-98117138 TCCCCATGGTGTACGAGTGCAGG No data
1029099517_1029099525 3 Left 1029099517 7:98117091-98117113 CCTGTAAAGTTACTCTGTCCTCC 0: 1
1: 0
2: 3
3: 8
4: 138
Right 1029099525 7:98117117-98117139 CCCCATGGTGTACGAGTGCAGGG 0: 1
1: 0
2: 1
3: 5
4: 61
1029099517_1029099528 21 Left 1029099517 7:98117091-98117113 CCTGTAAAGTTACTCTGTCCTCC 0: 1
1: 0
2: 3
3: 8
4: 138
Right 1029099528 7:98117135-98117157 CAGGGTCAACACTTAATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029099517 Original CRISPR GGAGGACAGAGTAACTTTAC AGG (reversed) Intronic
901621916 1:10595373-10595395 GGTGGAGAGAGTAACTGAACGGG + Intronic
903737027 1:25536407-25536429 GGAGGACACAGGAAGTTTAGGGG + Intergenic
905117606 1:35655887-35655909 GGAGAAGACAGTAACTTTGCTGG + Intergenic
905578328 1:39063793-39063815 GGGGGACAGTGTAACTATAAAGG + Intergenic
906003451 1:42447134-42447156 GGGTGAAAGAGTAACATTACAGG + Intronic
906896161 1:49774416-49774438 GGTGGACAGAGTAAGTGTTCTGG - Intronic
911242781 1:95483543-95483565 GGCGGACAGAGTGCCTTTTCAGG + Intergenic
916187163 1:162144764-162144786 GGAAGACAGAGAAACTGTTCTGG - Intronic
918027228 1:180762798-180762820 CTATGACAGAGTAACTCTACTGG + Intronic
922974377 1:229771383-229771405 GGAGGGCAGGGGAACTTCACTGG + Intergenic
1064484855 10:15775736-15775758 GGGGGACAGAGTAGGTTAACAGG - Intergenic
1065218509 10:23473416-23473438 GGAGGAGAGAGAAACAATACGGG - Intergenic
1066666960 10:37792536-37792558 GGAAAACACTGTAACTTTACAGG + Intronic
1073535881 10:104276025-104276047 GGAGGGCAGAGCAGCTTTGCTGG + Intronic
1076120035 10:127928584-127928606 GGAGGACAGATTAGCTGTGCTGG + Intronic
1078030754 11:7748700-7748722 GGAGGACAGATAGACTTCACTGG + Intergenic
1086341704 11:85854379-85854401 AGAGGAAAGAGGAACTTTAAAGG + Intergenic
1088369913 11:109077728-109077750 GGAGGAAAGAGTAAGTCCACAGG + Intergenic
1093846605 12:23979549-23979571 GTAGAACTGAGTAATTTTACTGG + Intergenic
1093945985 12:25110088-25110110 GGAGGACAAAGTAGTTTTATGGG + Intronic
1097394520 12:59057361-59057383 CCAGGACAGGGTAATTTTACAGG + Intergenic
1107107681 13:36663959-36663981 GGGGGAAAGAGTAACTCTATGGG + Intergenic
1107657492 13:42606500-42606522 AGAGGACAGACTCACTTTATGGG - Exonic
1108873662 13:55018447-55018469 GGAGGGCAGAATAACTTTTAGGG + Intergenic
1108957791 13:56182774-56182796 TGAGGACAGAGTGACTCTTCAGG + Intergenic
1111270540 13:85877306-85877328 GGAGAAAAGAGGGACTTTACTGG + Intergenic
1115812486 14:37125035-37125057 TGAGGACAGACTAACAATACAGG + Intronic
1116536184 14:46034052-46034074 GGAGGACACAATAACTGAACTGG - Intergenic
1118405348 14:65417381-65417403 GGAGGTAAGATTAACTTTATTGG - Intronic
1120860147 14:89247694-89247716 GGAGAACAGAGTAGGTTGACAGG - Intronic
1121834228 14:97077477-97077499 TGACGACAGAGAAACTCTACCGG + Intergenic
1125259460 15:37806393-37806415 GGAGGTAAAACTAACTTTACAGG + Intergenic
1126377442 15:48010463-48010485 GGAGGACAGAGTTGTTTTGCAGG - Intergenic
1128026095 15:64437983-64438005 GTAGGACTTAGTAATTTTACTGG + Intronic
1130436885 15:83909371-83909393 GGAAGACAGTGTACCTTTTCAGG + Intronic
1137661165 16:50207905-50207927 TCAGGACTGAGTAATTTTACTGG - Intronic
1137862029 16:51856272-51856294 GGAGGAGAGAGAAACTTGGCTGG + Intergenic
1138914258 16:61443721-61443743 GGGGAAGAGATTAACTTTACAGG + Intergenic
1139797136 16:69492392-69492414 GGCAGAAAGAGTAACTTTAAAGG + Intergenic
1141345031 16:83236994-83237016 GGAGGCCAGAGAAACTGGACAGG + Intronic
1142539732 17:648826-648848 GGAGGACAGAGGAATGGTACAGG + Intronic
1151561374 17:74871729-74871751 GGAGGACAAAGTCATTTTGCAGG + Intronic
1153610719 18:6881659-6881681 CGAGGTCAGAGTTACTTTATTGG + Intronic
1155773079 18:29724853-29724875 GGAGGAAAAAGTAGCTTTATGGG - Intergenic
1155838721 18:30621331-30621353 CTAATACAGAGTAACTTTACTGG + Intergenic
1156307602 18:35892894-35892916 GTAGGACTGAGCCACTTTACTGG + Intergenic
1158027917 18:52924472-52924494 GGAAGACAGAATAACTTGGCTGG + Intronic
1159967315 18:74607868-74607890 AGAGAACAGAGTAACTCTCCAGG - Intronic
1160413604 18:78691314-78691336 AGAAGAAAGCGTAACTTTACCGG + Intergenic
1160626995 18:80217430-80217452 GGAAGAAAGAGTAACTCTACAGG + Intronic
1164079103 19:21847394-21847416 GGAGAAGAAAGTAACATTACTGG + Intronic
1164921701 19:32093311-32093333 GGAGGCAAGAGTAAGTTTCCAGG + Intergenic
1165859030 19:38897473-38897495 GGAGCACAGAGAAAATTTTCTGG - Intronic
1166448066 19:42875845-42875867 GGAGGCCAGAGGAACTTGTCTGG + Intronic
1166452458 19:42914061-42914083 GGAGGCCAGAGGAACTTGTCTGG + Intronic
927009617 2:18889425-18889447 GAAGGTCATAGTAACTTTAGAGG - Intergenic
928051425 2:28000537-28000559 GAAAGAAAGAGTAGCTTTACAGG - Intronic
928684463 2:33733713-33733735 GGAGCTCAGTGCAACTTTACAGG - Intergenic
934568282 2:95352641-95352663 GGAGGGCAGAGGAAGTTTACAGG - Intronic
936674541 2:114699942-114699964 GAAAGACATAGGAACTTTACTGG + Intronic
937347726 2:121136967-121136989 TGAGGACAGAGTAAAATAACAGG + Intergenic
943982148 2:194567678-194567700 GCAGAACATAGTAACTATACTGG - Intergenic
946115896 2:217461826-217461848 GGAGGACAGAGAAATTGTGCAGG + Intronic
1169272216 20:4209390-4209412 GGAAAAAAGAATAACTTTACAGG - Intergenic
1169878965 20:10326799-10326821 AGAGGACAGAGAAGCTTTCCAGG + Intergenic
1172413243 20:34742182-34742204 AGAGGCCAGAGTAAGTTTAGGGG + Exonic
1173097904 20:40054546-40054568 GTAGGCCAGAGTAAGTTTAGGGG - Intergenic
1173676167 20:44837604-44837626 GGAGGACAGGATGCCTTTACTGG - Intergenic
1176408701 21:6436168-6436190 GGAGGACAGAGGAGCTTTACAGG - Intergenic
1177956547 21:27605993-27606015 GGAGGAAAGACTAAATCTACTGG + Intergenic
1179684195 21:43044488-43044510 GGAGGACAGAGGAGCTTTACAGG - Intergenic
1184276582 22:43412271-43412293 GGCGGCCAAAGTAACTTTGCGGG - Intronic
1185318666 22:50190297-50190319 GGAGGGCAGAGAAGCTTTCCTGG - Intronic
952911164 3:38187995-38188017 GGAGGAAAGGATAACTCTACTGG + Intronic
953115594 3:39989614-39989636 GGAGGAAAGAATAAGTCTACTGG + Intronic
955036618 3:55274302-55274324 GGAGGAAAGGGTAACTTTTAAGG - Intergenic
958686931 3:97410455-97410477 GGAGGTAAGAGTAGCTTTCCTGG - Intronic
960583098 3:119296902-119296924 GGAGGGCAGAGGAACCTAACAGG - Intronic
961866671 3:129958511-129958533 GGAGGACAGAAAAAGTTCACTGG + Intergenic
962899854 3:139752076-139752098 GTAGGACAGAGAAACTGTAGTGG + Intergenic
963822290 3:149910713-149910735 GGATAACAGAGTAGCTTTGCTGG + Intronic
964520311 3:157559296-157559318 GGAGCACAAAGAAACTTTTCAGG - Intronic
964550111 3:157876183-157876205 GGAGGCCAGAGTAGCTGGACTGG - Intergenic
965162714 3:165155099-165155121 GGGGAAAAGAGTAACTTTAGAGG + Intergenic
965484825 3:169265912-169265934 AGGGGACAGAGTAACATTAATGG + Intronic
965964577 3:174471263-174471285 AGAAGACAGAGTAATTTTAAAGG - Intronic
968782342 4:2592705-2592727 GGAGGCCAAAGTAAATTTGCAGG + Intronic
970155142 4:13133874-13133896 GGAGGAAAGGGTAAGTTTGCTGG - Intergenic
973910847 4:55578784-55578806 GGAGGAAATAGTAAGTTTATAGG - Intronic
974991164 4:69092548-69092570 GTAGGACAGAGTGACCTTTCTGG + Intronic
977375084 4:96192387-96192409 AGAGGAAAAAATAACTTTACAGG - Intergenic
977580701 4:98721905-98721927 GGAGGAAAGAGACACATTACTGG + Intergenic
978983049 4:114974780-114974802 GAAGGACAGAGAAACTGAACAGG + Intronic
983608459 4:169616931-169616953 GAAGTTCAGAGTAACTTTACTGG + Intronic
985285734 4:188335055-188335077 TGATTACAGAGTAACTTTCCAGG + Intergenic
990044493 5:51412421-51412443 AGAGGTCAGATTTACTTTACAGG - Intergenic
991074292 5:62517806-62517828 GGAGGTCAGAGTAACTCTTGTGG + Intronic
991294097 5:65062614-65062636 GGAGGACAGGGGAGCATTACAGG - Intergenic
993882951 5:93384130-93384152 GGGGGACAGAGTCATTTTATAGG - Intergenic
993962226 5:94313307-94313329 GGAGAAGAGAGTAACTTTTACGG + Intronic
1000494492 5:161963757-161963779 GGAGGGCTGAGAAATTTTACAGG - Intergenic
1000836047 5:166155661-166155683 ACAGGACAGAGGAACTTTTCAGG + Intergenic
1002151227 5:177232959-177232981 CTAGGACAGAGTAACTGTGCTGG + Intronic
1005295347 6:24420291-24420313 AGACGACAAAGTAACTTTACTGG - Intronic
1006230475 6:32581872-32581894 GGAAGACAGAGTAAGTCTCCTGG + Intronic
1007667691 6:43525149-43525171 GCAGGACAGAGTATCTTTCCAGG + Exonic
1008292049 6:49727914-49727936 GGGAAACATAGTAACTTTACAGG - Exonic
1012797673 6:103783712-103783734 AGAGAACAGATTATCTTTACTGG + Intergenic
1013109995 6:107057301-107057323 GGAGGAGATAGAAACATTACTGG + Intergenic
1013499431 6:110733075-110733097 GGAGTTCACAGAAACTTTACAGG - Intronic
1013773604 6:113653676-113653698 GCAGGACATAGAAACTTAACAGG - Intergenic
1013825434 6:114205439-114205461 GGAGGGCAGAGTAACTGGAGAGG - Intronic
1014864059 6:126506102-126506124 GGAGGAAAGACTAACTATGCTGG - Intergenic
1017166782 6:151415919-151415941 GGAGGGCAGTGTGACTATACAGG + Intronic
1017541200 6:155404814-155404836 TGAGGTCTGAGTAACTTCACAGG + Intronic
1020844304 7:13263005-13263027 GGAGGAGAGAACAACTGTACAGG + Intergenic
1020978857 7:15042486-15042508 AGAGGACAAAGAAACTTTCCAGG - Intergenic
1024433241 7:49315269-49315291 GGAAGACAGAGTAACCTAAATGG + Intergenic
1027369088 7:77489070-77489092 CAAGGACAGAATAACTGTACTGG + Intergenic
1028999980 7:97142848-97142870 GGAAGAAGGAGCAACTTTACAGG + Intronic
1029099517 7:98117091-98117113 GGAGGACAGAGTAACTTTACAGG - Intronic
1029338626 7:99924221-99924243 AGGGGAAAGAATAACTTTACAGG - Intronic
1030005230 7:105112062-105112084 GGAGGACAGTGCAACTTTGTTGG - Exonic
1031804626 7:126292898-126292920 GGAGGAAAGACTAAGTCTACTGG - Intergenic
1033020196 7:137716957-137716979 GAAGGAGAGAGTAAGGTTACTGG - Intronic
1033764828 7:144477086-144477108 GAAGATCAGATTAACTTTACTGG - Intronic
1035513806 8:214370-214392 GGAGGACATAACAAATTTACAGG - Intergenic
1038272276 8:26084963-26084985 GGAGGAAAGAGTAACTTGACAGG + Intergenic
1039861036 8:41457883-41457905 TGGGGAGAAAGTAACTTTACAGG + Intergenic
1040499835 8:47996623-47996645 GGAGCCCAGTGTAACTCTACTGG - Intergenic
1043054641 8:75422578-75422600 GGAGGAAAGATTAATTTCACTGG - Intronic
1044522053 8:93209980-93210002 GGTGCAGAGAGTAATTTTACTGG - Intergenic
1044872424 8:96632426-96632448 GGAGGGCAGAGAAAGTTTCCTGG - Intergenic
1046708873 8:117487203-117487225 GGAGGAAAGAGTAAGTCTGCTGG - Intergenic
1048876991 8:138844547-138844569 GGAGGACAGAGAAGCTTTCCTGG + Intronic
1051036164 9:12748338-12748360 TGAGGGCAGAGTAACTTTCAGGG - Intergenic
1051563871 9:18473960-18473982 GGAGGACAGAGAAAGTGTAACGG - Exonic
1055108537 9:72537192-72537214 GGAGGACAAAATAATTTTGCAGG - Intronic
1055702359 9:78959196-78959218 TGAGAACAGAGTCACTTTCCTGG + Intergenic
1057256561 9:93553492-93553514 GTTGGACAAAGTAACTTTACTGG + Intronic
1060751467 9:126172506-126172528 GGGGGAAAGAGTAACTTTCCAGG - Intergenic
1187361539 X:18632297-18632319 GGAGACCAGAGTTACTTTATAGG + Intronic
1188369986 X:29358064-29358086 GGAGGAGAGGGTGACTTTTCTGG + Intronic
1190568721 X:51759957-51759979 GGTGGAAAGAGTATCTTTATAGG + Intergenic
1196517240 X:116628370-116628392 GGAGGAGAGGGTAAGTCTACTGG + Intergenic
1196547159 X:116975695-116975717 GGAGGACAGAATAATTTTGTGGG + Intergenic
1197142451 X:123131653-123131675 GGAGGAAAGAGTAGCCTTAGGGG - Intergenic
1197531706 X:127636672-127636694 GAAGAACAGAATAACTTTTCAGG - Intergenic
1199528703 X:148823001-148823023 GGAGGATAGACTAGCTTTTCGGG - Intronic
1201739090 Y:17304226-17304248 GGAGGAAAGACTAATTTTGCTGG - Intergenic