ID: 1029099523

View in Genome Browser
Species Human (GRCh38)
Location 7:98117116-98117138
Sequence TCCCCATGGTGTACGAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029099517_1029099523 2 Left 1029099517 7:98117091-98117113 CCTGTAAAGTTACTCTGTCCTCC 0: 1
1: 0
2: 3
3: 8
4: 138
Right 1029099523 7:98117116-98117138 TCCCCATGGTGTACGAGTGCAGG No data
1029099516_1029099523 3 Left 1029099516 7:98117090-98117112 CCCTGTAAAGTTACTCTGTCCTC 0: 1
1: 0
2: 0
3: 16
4: 158
Right 1029099523 7:98117116-98117138 TCCCCATGGTGTACGAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029099523 Original CRISPR TCCCCATGGTGTACGAGTGC AGG Intronic
No off target data available for this crispr