ID: 1029100582

View in Genome Browser
Species Human (GRCh38)
Location 7:98126591-98126613
Sequence CGGTGTGGCCAAAAGAATGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029100582 Original CRISPR CGGTGTGGCCAAAAGAATGT CGG (reversed) Intronic
900132104 1:1091622-1091644 GGGTGGGGCCAAATGAAAGTGGG + Intronic
902830758 1:19010764-19010786 AGGGGTGGCCAAAAGAAAGGAGG + Intergenic
904033313 1:27546586-27546608 AGGTGTGGCCAGGAGCATGTGGG - Intronic
905659054 1:39706761-39706783 AGGTATGGCCAAAATAATTTGGG - Intronic
911031123 1:93489336-93489358 CTGTGGGGCCAAAAAATTGTTGG + Intronic
911443391 1:97959835-97959857 TCATGTGGCCAAATGAATGTGGG - Intergenic
915094994 1:153456214-153456236 AGGTGTGGCCCAAGGAAAGTGGG + Intergenic
918376275 1:183912308-183912330 TGGTGTGGCAAAGAGCATGTAGG - Intronic
922375355 1:224958447-224958469 AGGTGAGGCCAACAGAAAGTGGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063937476 10:11093332-11093354 AGGTGTAGCTAAAATAATGTTGG - Intronic
1064213784 10:13382912-13382934 GGGTGTGGACAGGAGAATGTAGG + Intergenic
1069817273 10:71206401-71206423 CAGTGTGGCCAAAACAAAGCAGG + Intergenic
1069912161 10:71766248-71766270 CAGGGTGGCCAAAAGCATGTGGG + Intronic
1070148020 10:73788822-73788844 CGGTGAGGCCAAAGGACTGATGG + Exonic
1070634710 10:78115942-78115964 CCTTGTGGCCAAAAGAAAGAGGG - Intergenic
1072729526 10:97836284-97836306 AGGGGTGGACAAAAGAATGAAGG - Intergenic
1073209457 10:101787394-101787416 AAGTGTGGCCAAAAGCATGATGG - Exonic
1073823467 10:107291875-107291897 CAGGGTGGCCAAGGGAATGTTGG - Intergenic
1080575305 11:33593485-33593507 CTGTGTGGCAAACAGACTGTAGG + Intronic
1083740092 11:64705127-64705149 AGGTGTGGCCCAAGGAATTTAGG + Intronic
1092489336 12:8930849-8930871 GGGAGTGGCCAGCAGAATGTGGG + Exonic
1094452502 12:30597453-30597475 CTGTGTGGCCAGTAAAATGTAGG - Intergenic
1096946456 12:55413688-55413710 GGGAGTGGCCAGCAGAATGTGGG - Intergenic
1098648426 12:72935193-72935215 TAGTGTGGCTAAAAGATTGTGGG + Intergenic
1100473408 12:94914043-94914065 AGGTATGGCGAAAAGAATATGGG + Intronic
1102569874 12:113820909-113820931 CCCTGTGGCCAAAAGAAAGCTGG - Intronic
1104473271 12:129048755-129048777 CCGTGTGGCCACAAGAATAGTGG + Intergenic
1107376535 13:39810462-39810484 TGGTGTGGTAAGAAGAATGTGGG - Intergenic
1113969781 13:114180102-114180124 AGGTGTGGGCAGAAGACTGTGGG - Intergenic
1117435824 14:55714440-55714462 AGGTGAGGCCAAGAGAATGAGGG - Intergenic
1120171272 14:81248916-81248938 TGATTTGGCCAATAGAATGTGGG + Intergenic
1122036570 14:98953551-98953573 TGGTGTGCCCAAGAGAAAGTGGG - Intergenic
1134644516 16:15855837-15855859 GGGTTTGGCAAAAAGAATGCAGG - Intronic
1141681448 16:85546706-85546728 AGTTCTGGCCAAGAGAATGTGGG - Intergenic
1142516883 17:437480-437502 TGCTTTGGCCAATAGAATGTGGG + Intergenic
1147307140 17:39572083-39572105 TGGTGAGGCAAAAAGCATGTTGG - Intergenic
1149324242 17:55513585-55513607 CCGAGTGGGCAAAAGAAAGTAGG - Intergenic
1151872192 17:76843977-76843999 CGGGGTGGTCAAATGAAGGTGGG + Intergenic
1152013297 17:77734279-77734301 CGGTGGGGCCTGATGAATGTTGG + Intergenic
1155627971 18:27858307-27858329 CGATGTGGCCTAGAGAGTGTGGG + Intergenic
1159878714 18:73837668-73837690 GAGTGTGGACAACAGAATGTTGG + Intergenic
1160489168 18:79322417-79322439 GGGTGCGGCCAGGAGAATGTCGG - Intronic
1160891500 19:1381005-1381027 CTGTGTGACCAACAGAATGGCGG - Intergenic
1164699141 19:30270090-30270112 AGTTGTGGCCAAATGAGTGTGGG - Intronic
1165404150 19:35619716-35619738 CAGCGTGCCCAACAGAATGTGGG - Exonic
1168514548 19:57000714-57000736 CTATGTGGCCAAAAGAGAGTGGG + Intergenic
927199430 2:20569124-20569146 CCGGGTAGCCAAAAGAATGGAGG + Intronic
927452067 2:23217276-23217298 TGTTCTGGCCAATAGAATGTAGG - Intergenic
928467531 2:31536497-31536519 GGGTGGGGCCAAAAGAATGAGGG - Intronic
929331463 2:40686487-40686509 TGCTTTGGCCTAAAGAATGTGGG - Intergenic
931764575 2:65443559-65443581 CAGTGTGGCCAATAAAATGTAGG + Intergenic
931965595 2:67529955-67529977 TGGTATGGCCAAAAGAAAATAGG + Intergenic
941101656 2:161302949-161302971 TGGTATGGCTAAAAGAATGGGGG + Intergenic
942495871 2:176539368-176539390 AGTTTTGGCCAACAGAATGTGGG + Intergenic
942552234 2:177131454-177131476 CTGTGTGGCAAATAGAATGCAGG + Intergenic
942623892 2:177878097-177878119 CTGTGTGACCAGATGAATGTAGG + Intronic
945905079 2:215583655-215583677 GGGTTGTGCCAAAAGAATGTAGG + Intergenic
946522229 2:220479002-220479024 CTGGGTGGCAGAAAGAATGTAGG - Intergenic
946559024 2:220891991-220892013 AGGTGTGGCCAGAAGCATGGGGG + Intergenic
947061318 2:226169800-226169822 AGTTTTGGCCAAAAGAATGCGGG - Intergenic
1169930136 20:10823722-10823744 CACTCTGGCCAATAGAATGTGGG + Intergenic
1170548025 20:17451595-17451617 TGCTTTGGCCAATAGAATGTGGG - Intronic
1172278293 20:33693172-33693194 CCTTGTGGCTAATAGAATGTGGG - Intergenic
1173308016 20:41870253-41870275 TGCACTGGCCAAAAGAATGTGGG - Intergenic
1179567163 21:42256377-42256399 CAGTCTGGCCAAGAGAATGGCGG - Intronic
1182110257 22:27718116-27718138 AGGTGTGGACAATAGATTGTGGG + Intergenic
1182250537 22:28996651-28996673 TACTGGGGCCAAAAGAATGTTGG + Intronic
1184296018 22:43526126-43526148 AGATGTGGCCAAGAGAATGTGGG + Intergenic
949390462 3:3556742-3556764 TGCTTTGGTCAAAAGAATGTAGG + Intergenic
950356756 3:12417201-12417223 TGGGGTGGCCAAAAGAATTTTGG + Intronic
952979687 3:38724606-38724628 TGATGTGGACAAAAGAAAGTGGG + Intronic
959262009 3:104094450-104094472 CTGTGTGGCCAAAACACTCTGGG + Intergenic
966564581 3:181362211-181362233 TGTTTTGGCCAATAGAATGTGGG + Intergenic
969546026 4:7828466-7828488 CAGTTTGGCCAAAGGAGTGTGGG + Intronic
970702886 4:18763850-18763872 AGGTGTGTCCAAAAGAAGGAAGG + Intergenic
970739545 4:19218829-19218851 CTGTGTGGAAAAGAGAATGTGGG - Intergenic
971419634 4:26463830-26463852 TGCTTTGGCCAAAAGAATGGGGG - Intergenic
972406956 4:38756055-38756077 TGCTTTGGCCAACAGAATGTAGG + Intergenic
977661392 4:99590602-99590624 GGGTTGGACCAAAAGAATGTTGG + Intronic
977910651 4:102531638-102531660 AAATGTGGCCAAAAGAATGTTGG + Intronic
979026143 4:115578815-115578837 TGCTTTGGCCAATAGAATGTGGG - Intergenic
980940639 4:139271037-139271059 ATGTGTGGCCCAAAGAATCTAGG + Intronic
982568618 4:157020171-157020193 TGCTTTGGCCAATAGAATGTAGG + Intergenic
986269226 5:6216897-6216919 CAGGGTGGCCAGAAGCATGTAGG + Intergenic
986376677 5:7139119-7139141 AGTTGTGGCCAAAAGGAGGTAGG - Intergenic
988229168 5:28451627-28451649 CTCTGTGTCTAAAAGAATGTTGG - Intergenic
990214916 5:53519740-53519762 CAGTATGGCCAAAAAAGTGTAGG - Intergenic
990777785 5:59322687-59322709 TGCTGTGGCTAACAGAATGTGGG + Intronic
991086407 5:62651903-62651925 CACTGTGGCCAAAAGACTGTGGG + Intergenic
991086551 5:62653131-62653153 CACTGTGGCCAAAAGACTGTGGG + Intergenic
992833547 5:80618589-80618611 AGTTTTGGCCAGAAGAATGTGGG + Intergenic
996520104 5:124416459-124416481 CTGTGTGCCCCAAAGACTGTAGG + Intergenic
999120528 5:149206207-149206229 AGTTGGGGCCAAGAGAATGTGGG - Intronic
999248464 5:150167632-150167654 CGGTGTTGCTAAATGAGTGTGGG - Intronic
1008500308 6:52174428-52174450 GGATTTGGCCAAAAGAGTGTGGG - Intergenic
1009934984 6:70223594-70223616 CGGTGTCAACAAGAGAATGTGGG + Intronic
1014824862 6:126037677-126037699 AGGTTTAGCCAAAATAATGTTGG - Intronic
1017998595 6:159557571-159557593 AGTTCTAGCCAAAAGAATGTGGG + Intergenic
1023426064 7:40037559-40037581 CTGTGTGACCAACAGAATATTGG - Intronic
1028500982 7:91518897-91518919 AGTTCTGGCCAACAGAATGTAGG + Intergenic
1029100582 7:98126591-98126613 CGGTGTGGCCAAAAGAATGTCGG - Intronic
1030801227 7:113855748-113855770 CTGTGTGTCCAAAAGAAAATAGG + Intergenic
1031262724 7:119542728-119542750 CTGTGTGGTTAAAAGAATGAAGG + Intergenic
1032705803 7:134420457-134420479 AATTGTAGCCAAAAGAATGTGGG + Intergenic
1035014246 7:155750862-155750884 CTGTGTGGCCAACAGAATAAAGG - Intronic
1035769597 8:2136357-2136379 AGGTGGGGCCAGAAGCATGTGGG + Intronic
1036124654 8:6051941-6051963 CGGTGTGACCCAGAGAATGCGGG - Intergenic
1036132427 8:6128349-6128371 TGCTGTGGCCAATTGAATGTGGG - Intergenic
1037678021 8:21068624-21068646 AGGTGTGGACAAGAGAAAGTGGG + Intergenic
1037997627 8:23364902-23364924 CGCTGTGGTCTAAAGAATGAGGG + Intronic
1045712962 8:105007364-105007386 TTCTGTGGCCCAAAGAATGTGGG - Intronic
1046611692 8:116432719-116432741 CGATGTGGCAAACAGAAGGTTGG - Intergenic
1047733976 8:127749831-127749853 AGGAGTGGCCAGAAGAGTGTGGG + Intergenic
1048427357 8:134335195-134335217 TTCTTTGGCCAAAAGAATGTGGG - Intergenic
1050018513 9:1260466-1260488 CTCTGTGGCCCAGAGAATGTGGG - Intergenic
1057204078 9:93160230-93160252 CGGTCTGGCCAAAAGATTGATGG + Intergenic
1061700811 9:132414079-132414101 TGTTGTGGCCAAAAGAACGTGGG - Intronic
1062111299 9:134783457-134783479 CAGGGTGGCCAAAAGACTCTTGG + Intronic
1186280418 X:7986976-7986998 CAGTGCCGCCATAAGAATGTGGG - Intergenic
1186353024 X:8759396-8759418 CAGTGCCGCCATAAGAATGTGGG + Intergenic
1189452977 X:41156783-41156805 CGGTCTGGTCCAAAGAAAGTTGG - Intronic
1196141521 X:112267975-112267997 CTGTGTGGAGAATAGAATGTAGG - Intergenic
1199610103 X:149605639-149605661 CAGTGTGGGAAAAAGAATGCAGG - Intronic