ID: 1029103193

View in Genome Browser
Species Human (GRCh38)
Location 7:98151641-98151663
Sequence TTTCCAGAAAGGATGTCTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 258}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029103186_1029103193 30 Left 1029103186 7:98151588-98151610 CCCCCTGTGGCAGCGTGGGGGCG 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1029103193 7:98151641-98151663 TTTCCAGAAAGGATGTCTTACGG 0: 1
1: 1
2: 0
3: 20
4: 258
1029103188_1029103193 28 Left 1029103188 7:98151590-98151612 CCCTGTGGCAGCGTGGGGGCGTG 0: 1
1: 0
2: 0
3: 7
4: 136
Right 1029103193 7:98151641-98151663 TTTCCAGAAAGGATGTCTTACGG 0: 1
1: 1
2: 0
3: 20
4: 258
1029103189_1029103193 27 Left 1029103189 7:98151591-98151613 CCTGTGGCAGCGTGGGGGCGTGA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1029103193 7:98151641-98151663 TTTCCAGAAAGGATGTCTTACGG 0: 1
1: 1
2: 0
3: 20
4: 258
1029103190_1029103193 -3 Left 1029103190 7:98151621-98151643 CCTTGCTGTGTGTCGAGCCTTTT 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1029103193 7:98151641-98151663 TTTCCAGAAAGGATGTCTTACGG 0: 1
1: 1
2: 0
3: 20
4: 258
1029103187_1029103193 29 Left 1029103187 7:98151589-98151611 CCCCTGTGGCAGCGTGGGGGCGT 0: 1
1: 0
2: 1
3: 10
4: 133
Right 1029103193 7:98151641-98151663 TTTCCAGAAAGGATGTCTTACGG 0: 1
1: 1
2: 0
3: 20
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029103193 Original CRISPR TTTCCAGAAAGGATGTCTTA CGG Intronic
900913331 1:5617522-5617544 TTCCCAGGGAGGATGTCTTGGGG - Intergenic
901141469 1:7035672-7035694 TCTCCCAAAAGGATCTCTTAAGG + Intronic
904015491 1:27416889-27416911 TATCCAGAAAGGATGTGCTTAGG + Intronic
904956106 1:34285196-34285218 TTTCCAGGAAGGGAGGCTTATGG + Intergenic
905303204 1:36999454-36999476 TTTCCAGAAAGGACCTTTTCAGG - Intronic
907165983 1:52411742-52411764 TTTCCTGAAAAGATGCCTCATGG - Intronic
908695893 1:66841420-66841442 TTTCCTTAATGAATGTCTTACGG + Intronic
908964689 1:69745150-69745172 TTCCCAGAAATGATGTTTAAAGG + Intronic
909712856 1:78672607-78672629 GTTCCAGAAAGGCTGTCTACAGG + Intergenic
909937136 1:81564859-81564881 TTTCCTGAATGAATGTCTTATGG + Intronic
910104322 1:83614891-83614913 TATTCAGAAAGGATGACTTTTGG + Intergenic
910542647 1:88378525-88378547 ATTCCAGAAAGCGTTTCTTATGG - Intergenic
910990506 1:93051200-93051222 TCTCCTGAAAGGAAATCTTAGGG - Intergenic
911981447 1:104572047-104572069 TTTTAAGTAAGGATGTCATAAGG + Intergenic
912832279 1:112964304-112964326 TTTAAAGAAAGAATGTCTTTAGG - Intergenic
913013393 1:114708384-114708406 CTTTCAGAAAGGGTGTCATATGG + Intronic
914948717 1:152090639-152090661 TTTCAAGAAAGTATGTCTCTGGG + Intergenic
916441104 1:164825596-164825618 TTTCCAAAAAGAAAGACTTAAGG - Intronic
917632269 1:176902141-176902163 GTTCGAGAAAAGATGTCTTTCGG + Intronic
917750672 1:178050433-178050455 TTTCCTGAAATGATGTCCTCTGG - Intergenic
919621038 1:199864984-199865006 TTTCTACTAAGGATGTCTCAGGG + Intergenic
921078969 1:211723783-211723805 TTTCCAGAAAGTAGGACTTCAGG + Intergenic
922212718 1:223497959-223497981 TTTACAGAAAGTATGTCCTAGGG + Intergenic
923910125 1:238431798-238431820 GTTCCAGAAAGGCTGTCTATAGG - Intergenic
1062776623 10:155108-155130 TTTTCAGAAAGCATCTCATATGG + Intronic
1063278243 10:4595431-4595453 TTTCCGGTAAAGAGGTCTTAGGG - Intergenic
1063298810 10:4833364-4833386 TTTCCACCAAGGACTTCTTATGG - Exonic
1063873786 10:10449863-10449885 TTTCTAGAAAGGCTCTCCTATGG - Intergenic
1066375820 10:34857035-34857057 TTTCCTGTTAGGATGCCTTAAGG + Intergenic
1067228313 10:44389598-44389620 TGTCCAGCAAGGAAGTCTTTGGG - Intergenic
1070823168 10:79375096-79375118 GTTCCAGAAAGCATGGCTCAAGG + Intergenic
1071231784 10:83596496-83596518 TTTCCATAATGGGTGTATTAGGG - Intergenic
1071880926 10:89897624-89897646 ATTCCAGAAAGGCTGTCTACAGG + Intergenic
1072620733 10:97077463-97077485 TTTCCCTAAAGGAAGTCTCAGGG + Intronic
1078867178 11:15308613-15308635 TTCCCAGAAAGGAGGTGATATGG + Intergenic
1078894967 11:15589879-15589901 TTTCCAGGCAGAATGTCTGAGGG + Intergenic
1079891680 11:26063661-26063683 TTCCCAGCAAGTATTTCTTAGGG - Intergenic
1080061865 11:27964988-27965010 TTTGCAGAAGGGATGTCTAGGGG - Intergenic
1081714785 11:45242120-45242142 TGTCCAGAAATTCTGTCTTAGGG + Exonic
1081998983 11:47382561-47382583 GTCCCAGATAGGATGGCTTAGGG + Intergenic
1082995455 11:59250971-59250993 TGTCAAGAAAGGTTGTCTTGAGG - Intergenic
1083797680 11:65027082-65027104 TTTCCAGAAAACATGAATTAGGG + Intronic
1084069505 11:66725137-66725159 TTTCCAGAAATGCTGTGATATGG + Intronic
1084302386 11:68260037-68260059 TCTCCAAAAAGGATGTCAAAGGG - Intergenic
1086210926 11:84317614-84317636 TTTCCAGAAAGGATGCATCTAGG + Intronic
1086777191 11:90852689-90852711 TTACCAGAAAAGATATCTTCAGG - Intergenic
1087364445 11:97201446-97201468 GTTCCAGAAAGGCTGTCTACAGG + Intergenic
1087918881 11:103843495-103843517 TAACCATAAAAGATGTCTTAAGG - Intergenic
1089199010 11:116712091-116712113 GTTGCAGACAGGATGACTTAGGG - Intergenic
1089709833 11:120306819-120306841 CTTCCATAAAGGCTGTCTAAGGG - Intronic
1092721310 12:11443774-11443796 TTTCCAACAAGGTTCTCTTAAGG - Intronic
1093410505 12:18859780-18859802 TGACCAGAAAGGATGGATTATGG + Intergenic
1093793588 12:23285197-23285219 TTTTCAGAAAAGATGACTAATGG - Intergenic
1094874538 12:34626264-34626286 ATTCCTGTAAGGATTTCTTATGG + Intergenic
1095179240 12:39127904-39127926 TTTCCTGAAGGGATTTATTAAGG + Intergenic
1096599076 12:52716611-52716633 TTTTCAGAAAAGGGGTCTTATGG + Intergenic
1098535817 12:71592468-71592490 ATTCCACAGAGGATGTGTTAGGG - Intergenic
1099556455 12:84114376-84114398 TTTATGGATAGGATGTCTTAAGG + Intergenic
1100478471 12:94955611-94955633 TCTCCAGAAATGATTTCTTTGGG - Intronic
1100554812 12:95682932-95682954 TTTCCAGAAATAGTGTTTTAAGG + Intronic
1102332793 12:112049356-112049378 TTTCTAGAAAGGATCTTTTTTGG - Intronic
1105419630 13:20240903-20240925 TTTCCAGAATACAAGTCTTATGG + Intergenic
1105523181 13:21150290-21150312 TTTCCCCTAAGGATTTCTTAAGG - Intergenic
1105825048 13:24115020-24115042 TTTCCAGAAACATTGTTTTAGGG + Intronic
1106044678 13:26127829-26127851 ATTCAAGAAAAGATTTCTTAGGG - Intergenic
1106518569 13:30476477-30476499 TGCCAAGAGAGGATGTCTTATGG + Intronic
1106627181 13:31432686-31432708 TTTCCAAAAAGAATCTCATATGG - Intergenic
1108213340 13:48159852-48159874 TTTCCAGAAAGGATCTCTTAAGG + Intergenic
1108793799 13:54006083-54006105 GGTCCAGAAAGGTTGTCTTTAGG - Intergenic
1110345518 13:74443231-74443253 TTTCCAGAAAGGGTCACTTGAGG - Intergenic
1110761108 13:79231173-79231195 TTTACAGAAAGGATGAATGAGGG - Intergenic
1111301343 13:86354571-86354593 TTTCCAGTAATGATGTTGTAGGG + Intergenic
1111989440 13:95102424-95102446 TTGCCAGAGATGGTGTCTTATGG - Intronic
1112703793 13:102043172-102043194 TTTCCTGCAAGGTTGTTTTAAGG - Intronic
1113562817 13:111296830-111296852 TTTCCCGAAACGATGTGTTGTGG + Intronic
1114926483 14:27406808-27406830 TTGCCAGAAAAGGTCTCTTAGGG - Intergenic
1115454175 14:33582088-33582110 TTTCCAGAAATGAAGTCAAAAGG + Intronic
1116076680 14:40119714-40119736 GTTCCAGAAGGGTTGTCTTTAGG + Intergenic
1116143096 14:41026067-41026089 TTTGCAGAAAGGATTTTTTAAGG - Intergenic
1116157556 14:41226725-41226747 TTTCCAAAAAGGATATTTCATGG + Intergenic
1117043530 14:51789855-51789877 TTTCCAGAAAGGTTTTCATTGGG - Intergenic
1117098067 14:52317119-52317141 ATTCCTGAAAGACTGTCTTAGGG + Intronic
1117405981 14:55404521-55404543 TTTCCATGAAGTATGTCTTTTGG + Intronic
1120027072 14:79598532-79598554 TATGCAGAAAGGATGTCAAAGGG + Intronic
1120297998 14:82668898-82668920 CTTCCAAAAAAGATGTATTATGG - Intergenic
1122674013 14:103395095-103395117 TTTCCTGAAGGGATGTGTGATGG + Intronic
1128505299 15:68265997-68266019 TTTCAAGAAAGGATGTTTATAGG + Intergenic
1128849091 15:70933427-70933449 CCTCCAGAAAGGATATGTTAGGG + Intronic
1129373538 15:75113104-75113126 GCTCCAGAAAGGGTGTCTCAAGG - Intronic
1132226922 15:100150006-100150028 CTAGCAGAAAGGATTTCTTAGGG - Intronic
1134346500 16:13396795-13396817 TTTCCTGAAAGGGTGTCTGGGGG + Intergenic
1137380634 16:47995706-47995728 CTTCCATAAAGGATGGCTTTGGG + Intergenic
1137666870 16:50255383-50255405 TTTCCAGAAACAGAGTCTTATGG - Intronic
1138868896 16:60856669-60856691 TGTCCAGAATGTATGTCTGAGGG + Intergenic
1139131165 16:64148035-64148057 TTTCTCGAAAGGATGTCGTTAGG + Intergenic
1140405700 16:74709837-74709859 TTTCCAGACATGCTGTCTTTGGG - Intergenic
1141553692 16:84822840-84822862 TTTCCTGAAAAGATGTATTGTGG + Intronic
1144164764 17:12599548-12599570 TTTGCAGAAAAGATTGCTTAGGG + Intergenic
1144335218 17:14262533-14262555 TTTCCAGAGAGGCTCTCTTTGGG - Intergenic
1144719974 17:17462425-17462447 TTTCCCGAAAGGGAATCTTAAGG - Intergenic
1145987308 17:29055698-29055720 TTTCCAGAAAGGATGGAATGAGG - Intronic
1146016200 17:29235682-29235704 CTTCCAGAAAGGAGGTCTCCTGG + Intergenic
1146277892 17:31526501-31526523 TTTCCTGGAAGGATGGCTTCTGG - Intronic
1146410276 17:32577525-32577547 TTTGCAGAAAGGATGCTTTTAGG + Intronic
1151097617 17:71517330-71517352 TTTTCAGAAAAGATGTCTTCCGG + Intergenic
1151107394 17:71632391-71632413 TTTCCAGGAAATATGTCATAAGG + Intergenic
1152086973 17:78226177-78226199 TTGTCAGAAAGGCTGTCATATGG + Intergenic
1153709725 18:7785281-7785303 TCTCCAGAAAAGATGTAATAAGG + Intronic
1155196449 18:23479319-23479341 TTTCCAGAAAGGAGGAGTCAAGG + Exonic
1157461330 18:47897919-47897941 TTTCTAAAAAGGATGCCTTTTGG - Intronic
1157750718 18:50175747-50175769 TTTCCAGCAAGGATGCCATAAGG - Intronic
1160532405 18:79573159-79573181 TTTCTATAAAAGATGTCTCAAGG + Intergenic
1162932667 19:13965146-13965168 TTTCTAGCAAGGCTGTCTAAAGG + Intronic
1163245065 19:16088376-16088398 TTCCCAGAGAGGATATCTCAGGG + Intronic
1164197807 19:22987197-22987219 TTTCCAGAAACTATTTCTTTTGG + Intronic
925471704 2:4169245-4169267 TTACAAGAAAGGATCTTTTATGG - Intergenic
929633151 2:43487325-43487347 TTGTCAGAAAGTATGGCTTAGGG - Intronic
930827895 2:55712694-55712716 TTATCAGAAAGGATATTTTAAGG - Intergenic
931264605 2:60649676-60649698 TTCCCAGAGTGGATCTCTTAAGG + Intergenic
932123753 2:69125004-69125026 TATACAGAAAGAACGTCTTAGGG + Intronic
933086289 2:78058546-78058568 GTTCCAGAAAGGCTGTCTATAGG + Intergenic
933122623 2:78560246-78560268 TTTCCAGAAAGTAAGTCAGACGG + Intergenic
933349701 2:81137592-81137614 GTTCCAGAAAGGCTGTCTACAGG - Intergenic
933485432 2:82916076-82916098 TTAGGAGAAAGGATGTCTTCCGG - Intergenic
937626600 2:124050882-124050904 TTTGAAGAAAGGATGTCTCTGGG - Intronic
937740629 2:125348518-125348540 ACTGCAGAAAGCATGTCTTAAGG - Intergenic
937756505 2:125545751-125545773 TCTCCAGGAGGGATGTGTTATGG - Intergenic
938708897 2:133958297-133958319 ATTCCAGAAAGGATGGCAGATGG + Intergenic
939467705 2:142580111-142580133 TTACCAGAAAGCATCTATTATGG + Intergenic
939622221 2:144434500-144434522 GTACCAGAAAGCATGTCTTTAGG + Intronic
940127566 2:150344032-150344054 TTTTCAGATAGGATGTCTCTTGG - Intergenic
940594692 2:155775421-155775443 ATTCCAGAAAGCATGTCATTTGG + Intergenic
941364533 2:164593761-164593783 TTTCCAGGAGGGATGCCTTCAGG + Intronic
942383424 2:175417472-175417494 TTTCCAGAAAGGATAATTCAGGG + Intergenic
942884586 2:180907968-180907990 TCTACAGAAAGGATGTCTAATGG + Intergenic
942887403 2:180943363-180943385 TTCCCAGAAATAATATCTTAGGG + Intergenic
943479021 2:188395384-188395406 GTTCCAGAAAGGCTGTCCTTTGG + Intronic
944883003 2:204034140-204034162 TCTCAAGAAAGGATCTATTAAGG - Intergenic
946368496 2:219266016-219266038 TTTCCAGGCAGGATGTCCTGAGG + Intronic
1169903898 20:10581058-10581080 TTTCCAGAAAAGCTGTGTTGAGG + Intronic
1173280622 20:41623751-41623773 TTTCCAGGAAGGTTGTTTAAGGG - Intergenic
1174594562 20:51673644-51673666 ATTCAAGAAAGGATGGCTTGTGG + Intronic
1176984420 21:15419974-15419996 TTTCCAGGATTGATGTCTTCAGG - Intergenic
1180269234 22:10569248-10569270 TTTTCAGAAAGAATGACTTTGGG + Intergenic
1180883810 22:19225354-19225376 TTTGCAGGAAGGCCGTCTTAAGG + Intronic
1183468125 22:37990333-37990355 TTTCCAGAAAGGATGGAGTTGGG - Intronic
1185031378 22:48444976-48444998 ATTCCAGGAAGGATGGCTTGGGG - Intergenic
949563763 3:5226652-5226674 TTTTCAGAGTGGATGGCTTATGG - Intergenic
951357024 3:21679841-21679863 TTTCCATATAGGATGACTTGGGG - Intronic
952217303 3:31290345-31290367 CTTCTAGAATGGAGGTCTTATGG + Intergenic
954806153 3:53222104-53222126 TTTCCAGCAAGGCTCTCTTCTGG - Intergenic
955607453 3:60720928-60720950 TTCCCAGAAAGGTTTTCTTCTGG - Intronic
956600020 3:71010671-71010693 TTTTTAGAAGGGATTTCTTATGG - Intronic
956751789 3:72349308-72349330 GTTTCACAGAGGATGTCTTATGG - Intergenic
957352011 3:79036640-79036662 TTTCCAGAAAGGAAGAATAAAGG - Intronic
957837960 3:85624004-85624026 TTGTCAGAAATGTTGTCTTAAGG + Intronic
958094217 3:88921253-88921275 TTTCCCTAAAGAATGTGTTATGG + Intergenic
959903637 3:111686833-111686855 TAACCAGAAAGGATGACTAAAGG - Intronic
960782172 3:121331372-121331394 GTTCCAGAAAGGGTGTCTACAGG - Intronic
960928664 3:122821770-122821792 TTTTAAAAAAGGATGTTTTAGGG - Intronic
961747091 3:129071146-129071168 TTCACAGAAAGGATGCCTGATGG + Intergenic
964307191 3:155354724-155354746 TTTCCAAAAAGGATTTCCAATGG + Intergenic
965468261 3:169059322-169059344 CTTCCAGAAATGATCTCTTTTGG - Intergenic
966581218 3:181566529-181566551 TTTCCAGGGAGTATGTCTTTAGG - Intergenic
970338981 4:15085059-15085081 TTCAGAGAAAGGATGACTTATGG - Intergenic
970586196 4:17516808-17516830 TTGCTATAAAGGATGTCTTCGGG + Intronic
971061790 4:22979427-22979449 GTTCCAGAAAGGCTGTCTATAGG - Intergenic
971282502 4:25252416-25252438 TTTCCAGAAAGAATCTCTCAAGG + Exonic
971660562 4:29408677-29408699 TTTCCAGGAAGCATTTCTAAAGG - Intergenic
972959009 4:44429178-44429200 TTTCCAGAAGGGATGCTTTTAGG - Intronic
973169854 4:47128086-47128108 TATCCAAAATGGATTTCTTATGG - Intronic
973775712 4:54239481-54239503 TCACCAGAAAAGATGTCATAGGG - Intronic
973909380 4:55564083-55564105 TGTCAAGAAAGTATATCTTAGGG + Intronic
974135851 4:57817064-57817086 TTTCCATAAAGAATCTCATATGG - Intergenic
974856422 4:67466417-67466439 GTTCCAGAAAGGCTGTCTAAAGG - Intergenic
975755544 4:77568087-77568109 TTACCAGAAATGATGTCACAGGG - Intronic
978448677 4:108805410-108805432 TTGCCAGAAAGGAGTACTTAAGG - Intergenic
978624983 4:110675094-110675116 TTTCCAGCAAGGCTGTTTGAAGG - Intergenic
979988554 4:127345467-127345489 TTTCCAAAAATGATGTCTCAAGG + Intergenic
980092155 4:128454385-128454407 GTCCCAGAAAGGATGTATTTCGG - Intergenic
980213478 4:129820215-129820237 TTTCCAGAGAGTATTTCCTAGGG - Intergenic
980506005 4:133722532-133722554 TTTCCTGAAAAGATTTTTTAAGG - Intergenic
980521670 4:133944527-133944549 TTTCCAGAACCAATGTCTTATGG - Intergenic
980991080 4:139738995-139739017 TTGCCAGGAAGGATGCCATAAGG - Intronic
981139658 4:141253802-141253824 GTTCCAGAAAGGCTGTCTACAGG + Intergenic
983619958 4:169750665-169750687 TTTCCAGCAAGGATATCATAAGG + Exonic
983704022 4:170635304-170635326 TTTACAGAGAAGATGTTTTATGG + Intergenic
985118301 4:186614301-186614323 TTTCCAGGAAGGACGTCTTCAGG + Exonic
986578584 5:9238621-9238643 TTTACAGAAAGGATGCCTACAGG + Intronic
987916896 5:24226963-24226985 GTTCCAGAAAGGCTGTCTACAGG + Intergenic
988994298 5:36699969-36699991 TTTACAGAAATGAAGTCTGATGG - Intergenic
989525883 5:42453725-42453747 GTTCCAGAAAGGCTGTCTACAGG + Intronic
991214679 5:64148772-64148794 TTTCCAGAAAGACTGTCTATAGG + Intergenic
992165963 5:74052084-74052106 CTTCCAGAAAGCATCTCTGAAGG + Intergenic
993220887 5:85096070-85096092 ATTCCAGTAAGGATGTGTTGTGG + Intergenic
993859471 5:93117579-93117601 TTTTCAAACAGGAAGTCTTATGG - Intergenic
994252653 5:97555101-97555123 TCTCCAAAAATAATGTCTTAAGG - Intergenic
994710164 5:103256727-103256749 TTTCTGGAAAGGATGCCTTGAGG + Intergenic
994874513 5:105400435-105400457 TTTCTAGGAAGTATGTCTCATGG - Intergenic
999482416 5:151960991-151961013 GTCCCAGAAAGGTTGACTTATGG + Intergenic
999915127 5:156250286-156250308 TTTGCAGAAAGGATGAGTGATGG + Intronic
1000505789 5:162116147-162116169 TTTCCAGAAAGGATTACTCTTGG + Intronic
1000831457 5:166106749-166106771 TTTTCAAAAAAGATGTGTTAGGG + Intergenic
1001297358 5:170507497-170507519 TTTCCAGAAATGAGCTGTTAAGG - Intronic
1002561691 5:180086782-180086804 TTTCCAGCAAGGATATCATAAGG + Intergenic
1005238758 6:23798565-23798587 TTTAAAGAAATGATGTATTAAGG - Intergenic
1005395364 6:25377122-25377144 ATTCCAGAAAGGCTGTCTACAGG + Intronic
1006489170 6:34371573-34371595 GTTTCAGAAAGGATCTCGTAAGG - Intronic
1007131719 6:39481593-39481615 TTGCCAGAAATGATTCCTTATGG + Intronic
1008185765 6:48388704-48388726 GCTCCAGAAAGGCTGTCTAAAGG + Intergenic
1008862434 6:56165633-56165655 TTTCTAGAAAGGATTTATTCTGG - Intronic
1008882555 6:56395397-56395419 TTTCCGGAAAGGCTGTCTATGGG - Intergenic
1009611031 6:65941389-65941411 TTTTCAAAAATAATGTCTTATGG + Intergenic
1010017433 6:71121633-71121655 TTTCCAGAAAGGCTATCTATAGG + Intergenic
1010821928 6:80424604-80424626 TTTCAAGAATGGGGGTCTTATGG - Intergenic
1011019976 6:82802141-82802163 TTTCCCAACAGGATGTCTTTCGG + Intergenic
1011402899 6:86983249-86983271 TTTGAAGAAATGATTTCTTAGGG - Intronic
1013495116 6:110690171-110690193 GTTCCAGAAAGGCTGTCTATAGG - Intronic
1014749930 6:125244652-125244674 GTTCCAGAAAGGCTGTCTATAGG + Intronic
1015530046 6:134212545-134212567 TTACTGGAAAGGATGTCTTCTGG - Intronic
1016031710 6:139344671-139344693 TTTCTAGAAAGGCTGTCTATAGG - Intergenic
1017198599 6:151728733-151728755 TTACCAAAAAGAATGTCTGATGG + Intronic
1018529887 6:164751434-164751456 TGTCCTCAATGGATGTCTTATGG - Intergenic
1019812011 7:3171746-3171768 TTTCCAGAGAGGAGGACTCAAGG + Intronic
1020571311 7:9866374-9866396 TTTCTAAAAAGAATGTCTTCTGG + Intergenic
1020592585 7:10159977-10159999 TTACCAGAAAGTATTTTTTAAGG - Intergenic
1020997480 7:15281348-15281370 ATTCCAGAAAGGCTGTCTATAGG - Intronic
1023160118 7:37288757-37288779 TTTCCAGAATTGAGGGCTTAAGG - Intronic
1024467805 7:49731262-49731284 TGTCCAGAGAGGATCTCTAAAGG + Intergenic
1025839792 7:65135362-65135384 TTCCTAGAAGGGTTGTCTTAAGG + Intergenic
1025883274 7:65560604-65560626 TTCCTAGAAGGGTTGTCTTAAGG - Intergenic
1025890172 7:65642003-65642025 TTCCTAGAAGGGTTGTCTTAAGG + Intergenic
1026442052 7:70453317-70453339 TTTCTAGTAAGTATCTCTTATGG + Intronic
1026973662 7:74482977-74482999 TTTCCCTAAAGGATGTTTTGTGG + Intronic
1027436517 7:78170606-78170628 ATGCCAGAAAGGATGTACTATGG + Intronic
1029103193 7:98151641-98151663 TTTCCAGAAAGGATGTCTTACGG + Intronic
1029198652 7:98824180-98824202 TTACCAGACAGGATGTTCTAAGG - Intergenic
1030928169 7:115483566-115483588 TTTCCAGGAAGATTGTCTTAGGG - Intergenic
1031852314 7:126879991-126880013 TTCCTAGAAAGGTTGTCTTAAGG - Intronic
1032741684 7:134746054-134746076 TTTCCAGAAATGGTGCCTTCAGG + Intronic
1032769945 7:135041881-135041903 TTTCCAAAAAGGATATGTGAAGG + Intronic
1033270922 7:139932283-139932305 TTTCCAGACATGAAGTCTCAGGG + Intronic
1033543161 7:142375925-142375947 TTCCCAGAAGGGTTGACTTAGGG - Intergenic
1033944713 7:146702120-146702142 TTTCCTGAAAGCAAGTCTTAGGG + Intronic
1034889549 7:154827772-154827794 CTCCCAGAAAGGATGTCCTGTGG + Intronic
1036442698 8:8795570-8795592 TTTCCAGCAAGGATAGATTAGGG + Intronic
1038186621 8:25280904-25280926 TTTCCAGAAAGAACATGTTAAGG - Intronic
1039412486 8:37366466-37366488 TGTCCAAAAAGGTTGTCTTGAGG - Intergenic
1039447869 8:37646961-37646983 TTCCCTGAAAGCATGTCTTCTGG + Intergenic
1039799380 8:40941102-40941124 TCTCCAGAAAGGATCTAGTAAGG + Intergenic
1039831415 8:41218131-41218153 TTCTCAGACAGCATGTCTTAGGG - Intergenic
1042020424 8:64368517-64368539 TTGCAAGAAAGGATGGCTTTAGG - Intergenic
1044958916 8:97510509-97510531 ATTCCAGAAAGGCTGTCAGAGGG - Intergenic
1046762356 8:118034385-118034407 GTTGCAGAAACGTTGTCTTAAGG - Intronic
1047384219 8:124394721-124394743 GTTCCAGAAAGGCTGTCTGTAGG + Intergenic
1048021106 8:130539965-130539987 GTGCCAGAGAGGATGTCTTATGG - Intergenic
1049375942 8:142289255-142289277 TTTCCAGAAAAGAAGGCTCAGGG - Intronic
1049825964 8:144668139-144668161 TTTTCAGAAAGGAAATTTTAAGG + Intergenic
1049873010 8:144995658-144995680 TTGCCAGAAATGATCTCTTTTGG + Intergenic
1051236058 9:15000394-15000416 TTTCCAGCAAGGATATTATAAGG - Intergenic
1051287010 9:15507978-15508000 TTAACAGAAATGATCTCTTAAGG - Intronic
1052232979 9:26177321-26177343 TTTCCAAACAGGATTTCTTCTGG + Intergenic
1052242875 9:26295967-26295989 GTTCCAGAAAGTTTGTCTTCTGG - Intergenic
1052625214 9:30966446-30966468 TATACAGAAAACATGTCTTATGG - Intergenic
1054717737 9:68573584-68573606 TTTCTAGAAAGGATATATTCAGG - Intergenic
1055480704 9:76706582-76706604 CTTCCAGAAAGGGTGACTGATGG + Exonic
1056705522 9:88949465-88949487 TTTCCAGAAGGGATGTCTCCCGG - Intergenic
1057072529 9:92112376-92112398 TTTCCAGAAAGGATTTGTGGTGG - Intronic
1057286250 9:93757006-93757028 TTTCCAGAAAAGCTGTCTGTAGG + Intergenic
1058674753 9:107390720-107390742 TTTCCATAAATGATGTCATTGGG - Intergenic
1059834022 9:118129621-118129643 GTTCCAGAAAGGCTGTCTATAGG - Intergenic
1060292699 9:122319005-122319027 ATTCCAGACAGGCTGTGTTAGGG - Intronic
1189663249 X:43326379-43326401 TTTCCAGAAAGGTTGTCTATAGG + Intergenic
1190443920 X:50503973-50503995 TTTCCAGCAATGATGGCTGAAGG - Intergenic
1193924229 X:87465310-87465332 TTTTCAGAAAGGTTGTCTACAGG - Intergenic
1194901853 X:99521250-99521272 GTTCCAGAAAGGCTGTCTAAGGG - Intergenic
1195090386 X:101452889-101452911 TTTTCAGAAAGGAGGTAGTAGGG + Intronic
1196187247 X:112757582-112757604 TTTCCATACAGGATCTCATAAGG + Intergenic
1196977743 X:121179120-121179142 GTTCCAGAAAGGCTGTCTATAGG + Intergenic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic