ID: 1029103308

View in Genome Browser
Species Human (GRCh38)
Location 7:98152617-98152639
Sequence CACAGCAAACAGTCAATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029103301_1029103308 18 Left 1029103301 7:98152576-98152598 CCCTGTCTTCACAAGGCTTAGAT 0: 1
1: 0
2: 3
3: 30
4: 284
Right 1029103308 7:98152617-98152639 CACAGCAAACAGTCAATTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 145
1029103302_1029103308 17 Left 1029103302 7:98152577-98152599 CCTGTCTTCACAAGGCTTAGATA 0: 1
1: 0
2: 0
3: 18
4: 124
Right 1029103308 7:98152617-98152639 CACAGCAAACAGTCAATTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029103308 Original CRISPR CACAGCAAACAGTCAATTGT GGG Intronic
902060891 1:13641553-13641575 CACTGCAAAGAGTCAATTTGTGG + Intergenic
903608169 1:24590232-24590254 CACGGCAAACACTCAAATGGTGG + Intronic
907787925 1:57632003-57632025 CACAACAAATATTCCATTGTAGG + Intronic
909308604 1:74115842-74115864 CCCACCAAAAAGTCAAATGTTGG + Intronic
910435952 1:87206324-87206346 CACAAGAAAGAGTAAATTGTAGG + Intergenic
911944470 1:104088840-104088862 TAAAGCAAACAGTCTATTTTTGG - Intergenic
912943403 1:114065204-114065226 CTCAGCTTACAGTCTATTGTGGG - Intergenic
916161711 1:161922841-161922863 CACATCAGACAGGGAATTGTAGG + Intronic
917153679 1:171972505-171972527 CACAGCAAACACTCAATAACTGG - Intronic
917388015 1:174498862-174498884 CATATCAAAGAGTCAATTCTTGG - Intronic
917571918 1:176275544-176275566 AACAGAAAATAGTCAAGTGTTGG - Intergenic
918448866 1:184640386-184640408 CTCAGCAAATAGTGAATTTTTGG + Intergenic
918596394 1:186298962-186298984 CAAATAAAACAGTAAATTGTAGG - Intronic
920201318 1:204261493-204261515 CCCAGCACACAGTCACCTGTTGG + Intronic
1064246129 10:13668907-13668929 CTCAGCAAACAGTTGCTTGTAGG - Intronic
1065113773 10:22464721-22464743 TACAGCAAACAGTCAAGGGGTGG + Intergenic
1065287422 10:24199605-24199627 CACATAAAACAGTCAACTGTAGG - Intronic
1066154901 10:32665270-32665292 CAAAGCAAACAATCAACAGTAGG - Intronic
1067492328 10:46722346-46722368 AACAGTAGACAGTCAATTGCCGG + Intergenic
1067602336 10:47618036-47618058 AACAGTAGACAGTCAATTGCCGG - Intergenic
1070247089 10:74743003-74743025 CACACAAAAAAGTAAATTGTTGG - Intergenic
1071653688 10:87423447-87423469 AACAGTAGACAGTCAATTGCCGG - Intergenic
1074239127 10:111619589-111619611 TAAAGCAAACAGTCAGTTCTAGG + Intergenic
1077631037 11:3811147-3811169 CACAGCACACAGCTAATTTTAGG + Intronic
1078363221 11:10686253-10686275 CACGTCAAACAGTAAGTTGTGGG + Intronic
1081185002 11:40031291-40031313 GACAGAAAACAGGCAGTTGTGGG - Intergenic
1081970844 11:47197627-47197649 CACAAAGAACAATCAATTGTGGG + Intergenic
1087650568 11:100862139-100862161 CACAGCAAACTGTGAGGTGTGGG + Intronic
1089717432 11:120375249-120375271 AACACCAAAGAGTGAATTGTTGG + Intronic
1092973042 12:13717278-13717300 CTCAGAAAACAGGCAATTCTGGG + Intronic
1093364056 12:18270653-18270675 AACAGAAAACAGTCTATTGTGGG + Intronic
1095688124 12:45058901-45058923 AACAGCCAACAGCCAATTGGTGG + Intergenic
1100716061 12:97307122-97307144 CACAGCAAACAGTGAGGTGCTGG + Intergenic
1101458994 12:104869860-104869882 CAGAGCAAATAGTCAATTAAAGG + Intronic
1104217908 12:126752549-126752571 CACTGCAATCAATCAATTGCTGG - Intergenic
1106951094 13:34884962-34884984 CACAGAAAACAGACATTTGCCGG + Intergenic
1108459964 13:50655696-50655718 CACAGGAAACATTCATTAGTTGG - Intronic
1108740846 13:53336846-53336868 AATAGCAAACACTCAATTATTGG - Intergenic
1108969329 13:56352479-56352501 GAAAGCAAACATTTAATTGTTGG + Intergenic
1110298114 13:73893680-73893702 CACAGTAAACAATCAATATTAGG - Intronic
1110934177 13:81263255-81263277 CACAACAATCAGTCAATAATTGG - Intergenic
1113010196 13:105755969-105755991 CACAGAAAACAGTTTATTGCAGG + Intergenic
1114453769 14:22842750-22842772 AAAAGCCAACAGTCATTTGTAGG + Intronic
1121028746 14:90639035-90639057 CACATAAAACAGTCCATTCTAGG + Intronic
1130173301 15:81540170-81540192 GACAACAAAAAGTCAAATGTAGG + Intergenic
1130228183 15:82075949-82075971 CACAGGAAAGAGACAATTTTGGG + Intergenic
1130370443 15:83282024-83282046 CACAGCAAACAGATCACTGTAGG + Intronic
1131606160 15:93904953-93904975 AACAGCAAAGAGTCCATTTTGGG + Intergenic
1131616482 15:94021749-94021771 CACAGCACACTGTGTATTGTGGG + Intergenic
1133737039 16:8623769-8623791 CACAGCAACCACTTAAATGTAGG + Intronic
1134331110 16:13251861-13251883 CTAAGTAAATAGTCAATTGTTGG - Intergenic
1135358939 16:21794644-21794666 CCCAGCAAACAGTCAGCTATAGG - Intergenic
1135457495 16:22611080-22611102 CCCAGCAAACAGTCAGCTATAGG - Intergenic
1136030389 16:27498619-27498641 CACAGCCAACAGGCAAGTGGAGG - Exonic
1136615744 16:31397544-31397566 CACAGCACACACTCATTTGCGGG - Intronic
1137701332 16:50500151-50500173 CACAGTAAACATTCAATGGACGG - Intergenic
1141894908 16:86953178-86953200 CACAGCAACCAGTCACTCCTTGG - Intergenic
1144365976 17:14545356-14545378 CACAGCAAACACACAAATGGAGG - Intergenic
1146566064 17:33914198-33914220 CATTGCAAACGGTCCATTGTGGG + Intronic
1148072995 17:44919558-44919580 CACAGCAAACAGAGAAGGGTAGG + Intergenic
1149244320 17:54687392-54687414 AACAGCAAACAGGCAATAATAGG + Intergenic
1153502761 18:5766020-5766042 CACAAAAAAAAGTCCATTGTAGG - Intergenic
1155249796 18:23943781-23943803 CACAGCAAACTGTGACCTGTTGG - Exonic
1157600139 18:48888636-48888658 CTCAGCACACGTTCAATTGTGGG - Intergenic
1158290839 18:55940468-55940490 CAGAGGAAACATTCAATTCTGGG - Intergenic
1158300725 18:56049060-56049082 CAAAGAAACCAGTAAATTGTGGG + Intergenic
1159903443 18:74069098-74069120 CAAAGCAAACTGTCATTGGTTGG - Intergenic
1164659957 19:29955598-29955620 CACAGGAAACAGCCAATTCAAGG - Intronic
1165082112 19:33313484-33313506 CACATCAAACTGTTAATGGTGGG + Intergenic
925211587 2:2052768-2052790 CACAGGAAAGAGTTAAGTGTTGG + Intronic
926389419 2:12372792-12372814 CAAAGCACACAGTCAAATGCAGG + Intergenic
927089230 2:19697924-19697946 CACACCCAACATTCAATGGTGGG + Intergenic
931590004 2:63872410-63872432 CACAGTAAATATTCAAATGTTGG - Intronic
932615802 2:73230787-73230809 CACAGCAAACAGGGTCTTGTAGG - Intronic
933153103 2:78938512-78938534 CACAGCAAGGAGACAAGTGTGGG + Intergenic
938409081 2:131048914-131048936 CACATCCAACAGTCAGCTGTCGG + Exonic
938551992 2:132391089-132391111 ATCAGCCAACAGTCAATTGGGGG - Intergenic
940202313 2:151165087-151165109 CACAGCAAATATTCTATTGAAGG + Intergenic
942206722 2:173626407-173626429 ACCAGCAATCAGTCAAGTGTTGG - Intergenic
943404624 2:187464721-187464743 CACAGCAAAGACTCAATTTAAGG + Exonic
943625897 2:190198984-190199006 CACAGGGAACAGTCAATAGGTGG + Intronic
946014486 2:216593010-216593032 CACAACAACCAGCCCATTGTTGG + Intergenic
1171362690 20:24600069-24600091 TACAGTATACAGTCATTTGTTGG + Intronic
1173197266 20:40926045-40926067 CACAGCCATCAATCAAATGTAGG + Intergenic
1182705224 22:32272763-32272785 CTCAGCAAAAAGTCAGTGGTGGG + Intergenic
949903480 3:8838955-8838977 CACAGCAGACAGCCAAGTGTAGG - Intronic
951481079 3:23163190-23163212 CACAGCAACCAGTCACTGGATGG - Intergenic
952505174 3:34000636-34000658 CCCATCAAACAGTCAAATGAGGG + Intergenic
954597468 3:51838804-51838826 CACAGGATATAGTCAATTGGTGG - Intergenic
954630366 3:52044721-52044743 CACAGCAAATTGACAATAGTTGG + Intergenic
955029246 3:55200647-55200669 GACAGCAAGCATTCAATTATCGG + Intergenic
955593212 3:60560116-60560138 GACAGTACACAGACAATTGTAGG + Intronic
956254815 3:67272438-67272460 CACAGCAAACAGCTATTTGGGGG + Intergenic
957316211 3:78579804-78579826 CACAGACAAAAGTCCATTGTTGG - Intergenic
961526985 3:127510191-127510213 CACATTAAAAAGTCAATTGAAGG + Intergenic
966099922 3:176255620-176255642 CCCAGCACACATTCAATTTTTGG - Intergenic
966798035 3:183734470-183734492 CATAGCAAACAGTGAAACGTAGG + Intronic
968316940 3:197732853-197732875 CCTTGCAAACAGTCACTTGTGGG + Intronic
970998875 4:22300178-22300200 CACAGAAAACAGTCACTCCTGGG + Intergenic
975866752 4:78731710-78731732 CAAAGCATACAGTCATCTGTTGG + Intergenic
977275862 4:94976702-94976724 CACACTAAACATTCAATGGTGGG + Intronic
979447880 4:120836075-120836097 CACAGCATACAGACAATTGAAGG + Intronic
981541289 4:145849288-145849310 CACAGGAAAATGTCAATTATTGG - Intronic
981735074 4:147940739-147940761 TACAGCAAAGAGTCATTTTTAGG + Intronic
981950659 4:150403051-150403073 CACAGTAAGCAGTCATTTATCGG + Intronic
983155813 4:164347030-164347052 CCCAGCAAACACTCAGTTGGAGG - Intronic
983890903 4:173028966-173028988 AACAACAAATAGTCAAATGTAGG - Intronic
985297918 4:188455419-188455441 CAAGGTAAACAGTCAGTTGTAGG - Intergenic
985970840 5:3377321-3377343 CACAGCTAACAGTCCATGATCGG + Intergenic
986120207 5:4828244-4828266 AAGAGCACACAGTCAATTGCTGG - Intergenic
990169419 5:53031073-53031095 CAAAACAAACAGGCAATTCTGGG - Intronic
991192541 5:63892061-63892083 CACAGTAAGCACTCAAATGTTGG - Intergenic
992021641 5:72630554-72630576 CACAGCAAAGTGTCACTTGCCGG - Intergenic
992385565 5:76280888-76280910 CACAGCAGACCCTCACTTGTCGG - Intronic
994494788 5:100498231-100498253 GACAGCAGACAGCCTATTGTGGG - Intergenic
995457529 5:112367906-112367928 CACTGCAAAGATTCAATTTTGGG - Intronic
996999969 5:129747783-129747805 CACAGGAAACAGTCACGTATAGG - Intergenic
999129732 5:149273285-149273307 CACAGCAAACAGGCAGATGGGGG - Intronic
999725969 5:154437992-154438014 CACAGCTAACAGTCCATTCCAGG - Intergenic
1000599766 5:163258256-163258278 AACAACACACAGTGAATTGTGGG + Intergenic
1001236688 5:170035753-170035775 CAGAGCACACAGTCAATGGGTGG - Intronic
1003289198 6:4764574-4764596 CACTGCACCCAGTCAGTTGTAGG + Intronic
1004732997 6:18376461-18376483 TACAGAAAAGAGTCAATTGAAGG + Intergenic
1005233334 6:23730663-23730685 CATAGCTAACACTCAATTCTTGG + Intergenic
1007772136 6:44200774-44200796 CAGAGGGAACAGTCAGTTGTTGG - Intergenic
1009472831 6:64049240-64049262 TACAGCAAAATGTTAATTGTAGG - Intronic
1010539616 6:77075458-77075480 GACATCAAACAGTTACTTGTTGG + Intergenic
1010919861 6:81668139-81668161 GACAGGAAACAGTCAAATGAAGG + Intronic
1011691138 6:89870267-89870289 CACAGCAAAAAATCGAGTGTTGG + Intronic
1012791363 6:103701520-103701542 CATAGCAAACAGAGAAATGTTGG - Intergenic
1017407908 6:154139681-154139703 CACAGCCATCAGTCAGTGGTCGG + Intronic
1029103308 7:98152617-98152639 CACAGCAAACAGTCAATTGTGGG + Intronic
1035796623 8:2363188-2363210 AACAGCAAACACACCATTGTAGG - Intergenic
1036991138 8:13596162-13596184 CACATCTTATAGTCAATTGTTGG + Intergenic
1037081605 8:14794251-14794273 CAAAGAAAACAGTAAATAGTAGG + Intronic
1041782409 8:61591537-61591559 CACAACTAACAGTAAATTCTTGG + Intronic
1046986581 8:120395158-120395180 CCCATCAAAGAGTCTATTGTAGG - Intronic
1052639900 9:31154151-31154173 CACAGCATACAGGTAATTTTTGG + Intergenic
1053274483 9:36772874-36772896 CTCAGCTAACAGTCAGGTGTGGG - Intergenic
1056196390 9:84232950-84232972 AACAACAAACAGTGAATTGAGGG - Intergenic
1058020409 9:100080223-100080245 CATAGCAAGCGTTCAATTGTAGG - Intronic
1058472573 9:105296128-105296150 CACAGCATGCACTCAATTCTTGG - Intronic
1058625200 9:106927273-106927295 TACAGCAATCGGTCAGTTGTGGG + Exonic
1059685436 9:116630743-116630765 CAAAGGAAACAGTCAATAGAGGG + Intronic
1059894373 9:118844514-118844536 CACAGCATGCAGTAAATTCTAGG + Intergenic
1060436630 9:123598571-123598593 AACTGAAAACAGTCAATTTTAGG - Intronic
1061119452 9:128634275-128634297 CACAGCAAACAGATACTTGAGGG + Exonic
1187402224 X:18971081-18971103 CACATATAACAGTCCATTGTGGG - Intronic
1187833235 X:23404444-23404466 CACAACAAAGAGTCAAATGTCGG + Intergenic
1191136856 X:57073826-57073848 CACATAAAACAGTTAAATGTAGG + Intergenic
1194925900 X:99822916-99822938 AACAGCACACTGTCAACTGTGGG + Intergenic