ID: 1029104527

View in Genome Browser
Species Human (GRCh38)
Location 7:98164637-98164659
Sequence GAGTCCTAACCAGGATCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 64}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029104527 Original CRISPR GAGTCCTAACCAGGATCACT GGG Intronic
902082253 1:13829106-13829128 CAGCCTTAACCAGGAGCACTCGG - Intergenic
904823994 1:33262828-33262850 GTGTCCTAAACTGGATCCCTAGG + Intronic
906119762 1:43381577-43381599 TAGACCTAAAAAGGATCACTGGG + Intergenic
916019638 1:160780467-160780489 GAGGCCTAGCCAGGATTCCTGGG + Intergenic
916164426 1:161952779-161952801 GAGTCACCACCAGGAACACTTGG - Intronic
923410576 1:233704747-233704769 GAGTCATCATCAGAATCACTAGG + Intergenic
1064486962 10:15802726-15802748 GGAGCCTAACCAGTATCACTGGG - Intronic
1067756967 10:49012545-49012567 GAGCCCTAACCAGGATGGCTGGG + Intergenic
1069899608 10:71699888-71699910 ATGCCCTGACCAGGATCACTTGG + Intronic
1069994907 10:72336160-72336182 GAGGCCTGACCAGGATGACAGGG - Intronic
1070156367 10:73838054-73838076 AGGTCCTCACCAGGTTCACTGGG + Intronic
1074172802 10:110960469-110960491 GAGTCCTGACCAGGCTGACCTGG + Intronic
1076140371 10:128073579-128073601 GAGACCAAGCCAGGACCACTAGG + Intronic
1077357070 11:2123330-2123352 AAGTCCTCTCCAGGATCCCTGGG - Intergenic
1081345691 11:41982938-41982960 GAGTCCTAACCAGTGTGGCTTGG + Intergenic
1083143052 11:60737547-60737569 AAGTCCCAACCAGGAGCACAGGG + Intronic
1085336543 11:75701141-75701163 GAGTCTGAGCCAGCATCACTAGG + Intergenic
1099922288 12:88973747-88973769 GAGCCCTAATGGGGATCACTGGG + Intergenic
1102228075 12:111243401-111243423 GAGGGCTAACCAGGGACACTGGG - Intronic
1106002377 13:25736386-25736408 GATTCCTACCCAGGAACACAGGG - Intronic
1112979903 13:105370661-105370683 GAGTCCTAGCCAGAATAATTAGG + Intergenic
1123082535 14:105702527-105702549 GAGCCCTGATCTGGATCACTAGG - Intergenic
1126204117 15:46023325-46023347 GAGTCCTAACAAGAATCAGATGG + Intergenic
1138473131 16:57254384-57254406 GAGTCCTAAGCAAGAGGACTGGG - Intronic
1140213432 16:72988579-72988601 GAATTCCAATCAGGATCACTTGG - Intronic
1142681219 17:1550077-1550099 GAGAGCTAACCTGGAGCACTTGG + Intronic
1148415991 17:47507000-47507022 GAGGGCAAACCAGAATCACTGGG - Intergenic
1148579788 17:48735537-48735559 GAGTCCTATCCAGTATCCCAGGG - Intergenic
1150282617 17:63938251-63938273 GAGTCCCAACAGGGATCACCTGG + Intergenic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
927224738 2:20752724-20752746 GAGGCCAAATCAGTATCACTGGG + Intronic
931962845 2:67501182-67501204 GAGTCCTGAGCAGGACCTCTGGG + Intergenic
936979423 2:118250499-118250521 GACTCCTGGCCAAGATCACTGGG - Intergenic
937372655 2:121311926-121311948 GAGTCCTAACCAGAGAAACTGGG + Intergenic
938366411 2:130737922-130737944 GAGACCTACCCAGGATCTCTCGG + Intergenic
945262212 2:207854012-207854034 GAGGCCTAGGCAGGATCACTTGG - Intronic
946310100 2:218878552-218878574 GAGTCCCCACCAGAATCACTGGG + Intergenic
948408713 2:237742732-237742754 GAGTCCTATCCAGGCTCTCCTGG - Intronic
948616715 2:239203969-239203991 GACTCCTAACCAGGAGCTGTGGG - Intronic
1171048791 20:21836542-21836564 TAGTGCTAACCAGAATCCCTGGG - Intergenic
1172693166 20:36804317-36804339 GAGCCTTAACCAGGAGCCCTGGG - Intronic
1173336787 20:42118610-42118632 GTGTCTTAACAAGGATCACCTGG - Intronic
950923904 3:16721326-16721348 GAGTCCTAACTCTGATCACTTGG - Intergenic
955814899 3:62831924-62831946 GAGTCTTGACCAAGATCTCTTGG + Intronic
961453550 3:127013473-127013495 GAGTCCTAGCCAGGCTCCCGGGG + Intronic
964883266 3:161447778-161447800 GAGTCCAGAGCAGGATAACTTGG - Intergenic
967067068 3:185927708-185927730 GAATGGTAACCAGGATAACTAGG + Intronic
968926407 4:3550889-3550911 GAGGCCTAGCCAGAGTCACTGGG + Intergenic
969498400 4:7539300-7539322 TAGTCCTCACCAGGAACACGGGG + Intronic
976035806 4:80819340-80819362 GACTCCTAACCAGAAGCCCTAGG - Intronic
984004192 4:174288749-174288771 AAGTCCTAGCCAGAATAACTAGG - Intronic
985372430 4:189300280-189300302 GAGTCCTAACTAAGAACAATAGG + Intergenic
987606691 5:20144812-20144834 GACTCCAAACCAAGATGACTGGG + Intronic
990842483 5:60098772-60098794 GAGTCCTAGCCAGGGCCACTAGG - Intronic
993880587 5:93356071-93356093 GAGTCCGAATCAGTTTCACTGGG - Intergenic
994590268 5:101762298-101762320 ATGGCCTACCCAGGATCACTGGG + Intergenic
995747584 5:115419811-115419833 GAGTCCTCAGAAGGAGCACTAGG + Intergenic
996881981 5:128309082-128309104 GAATCCCAAAGAGGATCACTTGG + Intronic
996957065 5:129196044-129196066 CAGCCCTAACCAGGATCCTTGGG + Intergenic
998179114 5:139924071-139924093 CAGCCCTCCCCAGGATCACTAGG + Intronic
1000567566 5:162868494-162868516 GATTCCTAACCTGGATGCCTTGG - Intergenic
1003242203 6:4354418-4354440 GAGCCCCCACCAGGAACACTGGG - Intergenic
1019845846 7:3500033-3500055 GAGTCCTGGTCAGGCTCACTGGG + Intronic
1020824055 7:13005086-13005108 AAGTCCTAGCCAGGATAATTAGG - Intergenic
1021083382 7:16389740-16389762 GAGTCCTAGCTAGGATAATTAGG + Intronic
1027251049 7:76398921-76398943 GAGTCACAGCCAGGAACACTGGG + Intronic
1029104527 7:98164637-98164659 GAGTCCTAACCAGGATCACTGGG + Intronic
1033910463 7:146257671-146257693 GAGTCCCCATCAGAATCACTGGG + Intronic
1044945676 8:97386694-97386716 GAGTGGCAATCAGGATCACTGGG + Intergenic
1057315113 9:93963161-93963183 GAGTCTTAACCATGCTCACTCGG + Intergenic
1058809035 9:108621106-108621128 CACTCCTAACCTGGATGACTGGG - Intergenic