ID: 1029104829

View in Genome Browser
Species Human (GRCh38)
Location 7:98166319-98166341
Sequence TGATTTCAGCAGAGGTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029104827_1029104829 -4 Left 1029104827 7:98166300-98166322 CCACACGGAGTGGCAGCTGTGAT 0: 1
1: 0
2: 1
3: 14
4: 102
Right 1029104829 7:98166319-98166341 TGATTTCAGCAGAGGTTCTCTGG No data
1029104821_1029104829 29 Left 1029104821 7:98166267-98166289 CCAAGGTGTGCACCTGTAGCTGG 0: 1
1: 0
2: 0
3: 23
4: 171
Right 1029104829 7:98166319-98166341 TGATTTCAGCAGAGGTTCTCTGG No data
1029104824_1029104829 17 Left 1029104824 7:98166279-98166301 CCTGTAGCTGGAGCGCTGGAGCC 0: 1
1: 0
2: 4
3: 15
4: 129
Right 1029104829 7:98166319-98166341 TGATTTCAGCAGAGGTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029104829 Original CRISPR TGATTTCAGCAGAGGTTCTC TGG Intronic
No off target data available for this crispr